Incidental Mutation 'R4410:Phgdh'
ID327848
Institutional Source Beutler Lab
Gene Symbol Phgdh
Ensembl Gene ENSMUSG00000053398
Gene Name3-phosphoglycerate dehydrogenase
SynonymsPGD, 3-PGDH, A10, PGAD, PGDH, SERA, 3PGDH
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4410 (G1)
Quality Score173
Status Validated
Chromosome3
Chromosomal Location98313170-98339990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98314275 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 447 (M447T)
Ref Sequence ENSEMBL: ENSMUSP00000064755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065793] [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect probably benign
Transcript: ENSMUST00000065793
AA Change: M447T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064755
Gene: ENSMUSG00000053398
AA Change: M447T

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 317 2.1e-42 PFAM
Pfam:2-Hacid_dh_C 111 285 3.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090746
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120541
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme which is involved in the early steps of L-serine synthesis in animal cells. L-serine is required for D-serine and other amino acid synthesis. The enzyme requires NAD/NADH as a cofactor and forms homotetramers for activity. Mutations in this gene have been found in a family with congenital microcephaly, psychomotor retardation and other symptoms. Multiple alternatively spliced transcript variants have been found, however the full-length nature of most are not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele die by E13.5 and exhibit abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Phgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Phgdh APN 3 98328315 missense probably damaging 1.00
R0195:Phgdh UTSW 3 98316550 unclassified probably benign
R0636:Phgdh UTSW 3 98333291 missense possibly damaging 0.89
R0787:Phgdh UTSW 3 98334549 missense probably damaging 1.00
R1626:Phgdh UTSW 3 98316409 missense probably benign 0.16
R1733:Phgdh UTSW 3 98328135 missense probably benign 0.00
R1782:Phgdh UTSW 3 98320747 missense probably damaging 0.97
R2173:Phgdh UTSW 3 98315111 missense probably benign 0.00
R2256:Phgdh UTSW 3 98328291 missense probably benign 0.30
R2367:Phgdh UTSW 3 98314296 missense probably benign 0.07
R2495:Phgdh UTSW 3 98339789 missense probably damaging 1.00
R4214:Phgdh UTSW 3 98328061 missense possibly damaging 0.79
R5062:Phgdh UTSW 3 98328339 missense probably damaging 1.00
R5378:Phgdh UTSW 3 98321323 unclassified probably null
R5528:Phgdh UTSW 3 98328339 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGGACATATAGACATGCCTGAG -3'
(R):5'- ACATGGGTAATTAGGCTGTGTC -3'

Sequencing Primer
(F):5'- AGGGCCCAATTCTAGGGATTC -3'
(R):5'- AATTAGGCTGTGTCTCTGTCTTC -3'
Posted On2015-07-07