Incidental Mutation 'R4410:Wdr3'
ID327849
Institutional Source Beutler Lab
Gene Symbol Wdr3
Ensembl Gene ENSMUSG00000033285
Gene NameWD repeat domain 3
SynonymsD030020G18Rik
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100138180-100162407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100140227 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 844 (T844M)
Ref Sequence ENSEMBL: ENSMUSP00000060613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052120] [ENSMUST00000164539]
Predicted Effect probably benign
Transcript: ENSMUST00000052120
AA Change: T844M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060613
Gene: ENSMUSG00000033285
AA Change: T844M

DomainStartEndE-ValueType
Blast:WD40 12 51 3e-16 BLAST
WD40 54 93 3.14e-6 SMART
WD40 96 135 1.04e-6 SMART
WD40 138 177 1.15e-4 SMART
WD40 180 219 4.24e-3 SMART
low complexity region 225 239 N/A INTRINSIC
Blast:WD40 267 307 3e-18 BLAST
low complexity region 316 331 N/A INTRINSIC
WD40 403 441 8.49e-3 SMART
WD40 444 481 1.71e1 SMART
WD40 484 523 2.1e-7 SMART
WD40 538 576 1.2e-2 SMART
WD40 579 618 2.45e-8 SMART
WD40 621 660 5.47e-6 SMART
WD40 663 702 1.03e-10 SMART
low complexity region 711 724 N/A INTRINSIC
Pfam:Utp12 803 906 6.4e-25 PFAM
low complexity region 927 936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146989
SMART Domains Protein: ENSMUSP00000134945
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164539
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing 10 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, which usually include a trp-asp at the C-terminal end. Proteins belonging to the WD repeat family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Wdr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Wdr3 APN 3 100148108 missense probably damaging 1.00
IGL00706:Wdr3 APN 3 100148100 unclassified probably benign
IGL01391:Wdr3 APN 3 100146789 unclassified probably benign
IGL02008:Wdr3 APN 3 100150982 missense probably damaging 0.97
IGL02136:Wdr3 APN 3 100138725 nonsense probably null
IGL02215:Wdr3 APN 3 100146700 critical splice donor site probably null
IGL02505:Wdr3 APN 3 100151974 missense probably benign
IGL03412:Wdr3 APN 3 100151977 missense probably benign 0.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0369:Wdr3 UTSW 3 100156418 nonsense probably null
R0865:Wdr3 UTSW 3 100152796 unclassified probably benign
R0966:Wdr3 UTSW 3 100161069 missense probably damaging 0.99
R1168:Wdr3 UTSW 3 100142219 missense probably benign 0.11
R1612:Wdr3 UTSW 3 100151199 splice site probably benign
R1768:Wdr3 UTSW 3 100153870 missense probably benign
R2060:Wdr3 UTSW 3 100159897 unclassified probably null
R3793:Wdr3 UTSW 3 100151965 missense probably benign 0.02
R3888:Wdr3 UTSW 3 100153906 missense probably benign
R4596:Wdr3 UTSW 3 100152867 missense possibly damaging 0.95
R4609:Wdr3 UTSW 3 100140200 missense probably damaging 1.00
R4817:Wdr3 UTSW 3 100146545 missense possibly damaging 0.71
R5016:Wdr3 UTSW 3 100141620 intron probably benign
R5024:Wdr3 UTSW 3 100154936 missense probably benign
R5411:Wdr3 UTSW 3 100142984 missense probably damaging 1.00
R5430:Wdr3 UTSW 3 100157327 missense possibly damaging 0.88
R5902:Wdr3 UTSW 3 100144491 unclassified probably benign
R6177:Wdr3 UTSW 3 100161152 missense probably damaging 0.97
R6445:Wdr3 UTSW 3 100156403 missense possibly damaging 0.65
R6516:Wdr3 UTSW 3 100145676 missense probably damaging 1.00
R6624:Wdr3 UTSW 3 100144326 missense probably damaging 1.00
R6747:Wdr3 UTSW 3 100138724 missense probably damaging 1.00
R6813:Wdr3 UTSW 3 100138725 nonsense probably null
R6899:Wdr3 UTSW 3 100149901 missense possibly damaging 0.90
R7024:Wdr3 UTSW 3 100154997 missense probably benign 0.00
X0012:Wdr3 UTSW 3 100145630 splice site probably null
Z1088:Wdr3 UTSW 3 100144344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGGATCCTTGTTTTAAAG -3'
(R):5'- AACTCTGAGTGGACAGAATTCAC -3'

Sequencing Primer
(F):5'- CAGGATCCTTGTTTTAAAGGCAGG -3'
(R):5'- CTCTGAGTGGACAGAATTCACAAAAG -3'
Posted On2015-07-07