Incidental Mutation 'R4410:Zmym1'
ID327851
Institutional Source Beutler Lab
Gene Symbol Zmym1
Ensembl Gene ENSMUSG00000043872
Gene Namezinc finger, MYM domain containing 1
Synonyms
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location127047094-127061152 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 127048104 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 830 (C830*)
Ref Sequence ENSEMBL: ENSMUSP00000101708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055013] [ENSMUST00000106099] [ENSMUST00000106102]
Predicted Effect probably null
Transcript: ENSMUST00000055013
AA Change: C830*
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872
AA Change: C830*

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106099
AA Change: C732*
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872
AA Change: C732*

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106102
AA Change: C830*
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872
AA Change: C830*

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152607
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Other mutations in Zmym1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zmym1 APN 4 127049642 missense probably damaging 1.00
IGL02326:Zmym1 APN 4 127047760 missense probably damaging 1.00
IGL02392:Zmym1 APN 4 127048463 missense probably damaging 1.00
IGL02431:Zmym1 APN 4 127047764 nonsense probably null
IGL02512:Zmym1 APN 4 127048672 missense probably damaging 1.00
IGL03303:Zmym1 APN 4 127049134 missense probably damaging 1.00
R0195:Zmym1 UTSW 4 127047911 missense possibly damaging 0.85
R0266:Zmym1 UTSW 4 127048025 missense possibly damaging 0.86
R0416:Zmym1 UTSW 4 127058820 missense probably benign 0.00
R1374:Zmym1 UTSW 4 127049611 missense probably damaging 1.00
R1480:Zmym1 UTSW 4 127048612 missense probably damaging 0.99
R1704:Zmym1 UTSW 4 127048384 missense probably damaging 1.00
R1806:Zmym1 UTSW 4 127048079 missense probably damaging 1.00
R1815:Zmym1 UTSW 4 127049021 missense possibly damaging 0.76
R2124:Zmym1 UTSW 4 127049570 missense probably benign 0.05
R2169:Zmym1 UTSW 4 127054203 splice site probably null
R4027:Zmym1 UTSW 4 127049879 missense probably benign 0.08
R4572:Zmym1 UTSW 4 127050835 missense probably benign 0.39
R4788:Zmym1 UTSW 4 127054297 missense probably benign 0.10
R5120:Zmym1 UTSW 4 127051437 splice site probably null
R5130:Zmym1 UTSW 4 127048658 missense probably damaging 1.00
R5615:Zmym1 UTSW 4 127049398 missense probably damaging 1.00
R6190:Zmym1 UTSW 4 127047884 missense probably damaging 0.99
T0722:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0722:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0722:Zmym1 UTSW 4 127049673 missense probably benign 0.05
T0975:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0975:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0975:Zmym1 UTSW 4 127049673 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGTGGAGAGCATGCTGAATAAAC -3'
(R):5'- AGGGTTTTGATGTTGAGAAACCC -3'

Sequencing Primer
(F):5'- CTAGGTCAATGAAGCTTAAGGACCC -3'
(R):5'- TTGATGTTGAGAAACCCTCTTTTC -3'
Posted On2015-07-07