Incidental Mutation 'R4410:Lmod2'
ID327854
Institutional Source Beutler Lab
Gene Symbol Lmod2
Ensembl Gene ENSMUSG00000029683
Gene Nameleiomodin 2 (cardiac)
SynonymsC-Lmod
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24597762-24605414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24604630 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 535 (S535R)
Ref Sequence ENSEMBL: ENSMUSP00000031694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031694]
Predicted Effect probably damaging
Transcript: ENSMUST00000031694
AA Change: S535R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031694
Gene: ENSMUSG00000029683
AA Change: S535R

DomainStartEndE-ValueType
Pfam:Tropomodulin 6 153 9.7e-19 PFAM
PDB:1IO0|A 202 360 5e-45 PDB
low complexity region 361 374 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 421 453 N/A INTRINSIC
low complexity region 482 490 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in thin filaments in the heart, cardiac contractile dysfunction, abnormal myocardial fiber ultrastucture, dilated cardiomyopathy, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Lmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lmod2 APN 6 24598052 missense probably damaging 1.00
IGL01013:Lmod2 APN 6 24604135 missense probably damaging 0.98
IGL02164:Lmod2 APN 6 24603910 missense possibly damaging 0.89
IGL02328:Lmod2 APN 6 24603833 missense probably benign 0.00
IGL02956:Lmod2 APN 6 24603632 missense probably damaging 1.00
IGL03213:Lmod2 APN 6 24603616 missense possibly damaging 0.88
IGL03351:Lmod2 APN 6 24598016 missense probably benign 0.00
P0035:Lmod2 UTSW 6 24597886 missense probably damaging 1.00
R1764:Lmod2 UTSW 6 24603377 missense probably damaging 0.99
R3104:Lmod2 UTSW 6 24604472 missense probably damaging 1.00
R3955:Lmod2 UTSW 6 24603871 missense probably benign 0.02
R4876:Lmod2 UTSW 6 24604279 missense probably benign 0.06
R4957:Lmod2 UTSW 6 24603872 missense possibly damaging 0.63
R5509:Lmod2 UTSW 6 24603889 missense probably damaging 1.00
R5655:Lmod2 UTSW 6 24603854 missense possibly damaging 0.65
R6114:Lmod2 UTSW 6 24603692 missense probably damaging 1.00
R6462:Lmod2 UTSW 6 24604301 missense probably benign 0.06
R6834:Lmod2 UTSW 6 24597783 start gained probably benign
R6869:Lmod2 UTSW 6 24604127 missense probably benign 0.06
R6909:Lmod2 UTSW 6 24604158 missense probably benign 0.00
R6918:Lmod2 UTSW 6 24603595 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCATTAAACAACAGGAAAGTGCC -3'
(R):5'- ATTCGTTCTCACCATCAGGG -3'

Sequencing Primer
(F):5'- GCGCGCCCTACAAAATGG -3'
(R):5'- GTACCCACCCTAGTGCTCACATG -3'
Posted On2015-07-07