Incidental Mutation 'R4410:Ddias'
ID327859
Institutional Source Beutler Lab
Gene Symbol Ddias
Ensembl Gene ENSMUSG00000030641
Gene NameDNA damage-induced apoptosis suppressor
Synonymsnoxin, 4632434I11Rik
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92857525-92874247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92858079 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 876 (L876P)
Ref Sequence ENSEMBL: ENSMUSP00000032877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032877] [ENSMUST00000208356] [ENSMUST00000209074]
Predicted Effect probably benign
Transcript: ENSMUST00000032877
AA Change: L876P

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032877
Gene: ENSMUSG00000030641
AA Change: L876P

DomainStartEndE-ValueType
Pfam:Rep_fac-A_C 7 118 2.1e-14 PFAM
low complexity region 197 209 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 727 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208356
Predicted Effect probably benign
Transcript: ENSMUST00000209074
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Ddias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Ddias APN 7 92866622 missense probably damaging 0.98
IGL02820:Ddias APN 7 92859343 missense probably benign 0.07
I0000:Ddias UTSW 7 92866640 missense possibly damaging 0.69
R0094:Ddias UTSW 7 92859900 missense possibly damaging 0.61
R0482:Ddias UTSW 7 92859528 missense probably benign 0.41
R0883:Ddias UTSW 7 92859337 missense probably benign
R1131:Ddias UTSW 7 92859886 missense possibly damaging 0.92
R1722:Ddias UTSW 7 92860042 missense possibly damaging 0.63
R1758:Ddias UTSW 7 92859363 missense probably benign 0.03
R1937:Ddias UTSW 7 92858622 missense probably benign 0.07
R2067:Ddias UTSW 7 92859699 missense possibly damaging 0.79
R2124:Ddias UTSW 7 92858256 missense probably benign 0.00
R2483:Ddias UTSW 7 92859592 missense probably benign 0.13
R3623:Ddias UTSW 7 92859592 missense probably benign 0.13
R3690:Ddias UTSW 7 92860158 missense probably benign 0.24
R4015:Ddias UTSW 7 92859861 missense probably benign 0.06
R4021:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4022:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4384:Ddias UTSW 7 92858223 missense probably damaging 0.98
R4691:Ddias UTSW 7 92858816 missense probably damaging 0.99
R5653:Ddias UTSW 7 92858729 missense probably damaging 1.00
R6666:Ddias UTSW 7 92858081 missense probably benign
R6853:Ddias UTSW 7 92859565 missense possibly damaging 0.46
X0027:Ddias UTSW 7 92858995 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATTCTGAAAAGCCATCCCCAACTG -3'
(R):5'- TATGAAGCCACCTCAGCCTG -3'

Sequencing Primer
(F):5'- AACTGGGCTTTTCCTATTTTCAG -3'
(R):5'- TCAGCCTGCTCAAAGAATGTAAAAG -3'
Posted On2015-07-07