Incidental Mutation 'R4410:Folr2'
ID327861
Institutional Source Beutler Lab
Gene Symbol Folr2
Ensembl Gene ENSMUSG00000032725
Gene Namefolate receptor 2 (fetal)
SynonymsFBP2, Folbp-2, FR-P3, Folbp2, Folbp2
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101839988-101857194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101840674 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 129 (E129G)
Ref Sequence ENSEMBL: ENSMUSP00000147920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035836] [ENSMUST00000094141] [ENSMUST00000165052] [ENSMUST00000185929] [ENSMUST00000209329] [ENSMUST00000210598] [ENSMUST00000211566]
Predicted Effect probably benign
Transcript: ENSMUST00000035836
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094141
AA Change: E129G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091692
Gene: ENSMUSG00000032725
AA Change: E129G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Folate_rec 29 203 2.5e-64 PFAM
low complexity region 233 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098239
Predicted Effect probably benign
Transcript: ENSMUST00000165052
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185929
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209329
AA Change: E129G

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209861
Predicted Effect probably damaging
Transcript: ENSMUST00000210598
AA Change: E129G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211514
Predicted Effect probably benign
Transcript: ENSMUST00000211566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211793
Meta Mutation Damage Score 0.756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and physically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Folr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Folr2 APN 7 101840386 missense probably damaging 0.98
Frontier UTSW 7 101840674 missense probably damaging 0.97
R4214:Folr2 UTSW 7 101843699 missense probably damaging 0.96
R4755:Folr2 UTSW 7 101843799 missense possibly damaging 0.86
R4944:Folr2 UTSW 7 101840290 unclassified probably null
R5421:Folr2 UTSW 7 101840644 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGCAGAATCATAGTGGGC -3'
(R):5'- CCAAGACTCCTGCCTGTATGAG -3'

Sequencing Primer
(F):5'- TCATAGTGGGCACAGACATTTAGACC -3'
(R):5'- GTATGAGTGCTCCCCCAAC -3'
Posted On2015-07-07