Incidental Mutation 'R4410:Tmem59l'
ID327864
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Nametransmembrane protein 59-like
Synonyms
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4410 (G1)
Quality Score111
Status Validated
Chromosome8
Chromosomal Location70483867-70487358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70487301 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 6 (L6S)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
Predicted Effect unknown
Transcript: ENSMUST00000045286
AA Change: L6S
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: L6S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70485665 splice site probably benign
IGL01479:Tmem59l APN 8 70486098 missense probably benign 0.00
IGL01783:Tmem59l APN 8 70487224 missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70484781 missense probably benign 0.16
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70484387 nonsense probably null
R1540:Tmem59l UTSW 8 70485154 missense probably benign 0.05
R1775:Tmem59l UTSW 8 70486253 missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70487301 missense unknown
R2238:Tmem59l UTSW 8 70485122 missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70487301 missense unknown
R2315:Tmem59l UTSW 8 70487301 missense unknown
R2969:Tmem59l UTSW 8 70487301 missense unknown
R2970:Tmem59l UTSW 8 70487301 missense unknown
R3011:Tmem59l UTSW 8 70486237 missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70487301 missense unknown
R3726:Tmem59l UTSW 8 70487301 missense unknown
R3774:Tmem59l UTSW 8 70487301 missense unknown
R3775:Tmem59l UTSW 8 70487301 missense unknown
R3826:Tmem59l UTSW 8 70487301 missense unknown
R3827:Tmem59l UTSW 8 70487301 missense unknown
R3828:Tmem59l UTSW 8 70487301 missense unknown
R3829:Tmem59l UTSW 8 70487301 missense unknown
R3851:Tmem59l UTSW 8 70487301 missense unknown
R3943:Tmem59l UTSW 8 70487301 missense unknown
R3944:Tmem59l UTSW 8 70487301 missense unknown
R4064:Tmem59l UTSW 8 70485719 missense probably damaging 1.00
R4409:Tmem59l UTSW 8 70487301 missense unknown
R4422:Tmem59l UTSW 8 70486099 missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70487301 missense unknown
R4471:Tmem59l UTSW 8 70487301 missense unknown
R4767:Tmem59l UTSW 8 70486098 missense probably benign 0.00
R5321:Tmem59l UTSW 8 70487215 missense probably damaging 1.00
R6130:Tmem59l UTSW 8 70484605 missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70486125 missense probably damaging 1.00
R6603:Tmem59l UTSW 8 70486356 missense probably benign 0.31
R6750:Tmem59l UTSW 8 70486372 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCCATCTGAGGGTCCTACAC -3'
(R):5'- GATCCAAGTCCGGTCAAAGAGC -3'

Sequencing Primer
(F):5'- AGGGTCCTACACTCAGGTC -3'
(R):5'- TCAGTGACGTCAACACC -3'
Posted On2015-07-07