Incidental Mutation 'R4410:Cdca4'
ID327875
Institutional Source Beutler Lab
Gene Symbol Cdca4
Ensembl Gene ENSMUSG00000047832
Gene Namecell division cycle associated 4
Synonyms2410018C03Rik, SEI-3, Hepp
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112820229-112829423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112821879 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 76 (H76Q)
Ref Sequence ENSEMBL: ENSMUSP00000152315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062092] [ENSMUST00000220899]
Predicted Effect probably benign
Transcript: ENSMUST00000062092
AA Change: H76Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058901
Gene: ENSMUSG00000047832
AA Change: H76Q

DomainStartEndE-ValueType
Pfam:SERTA 33 70 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220899
AA Change: H76Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the E2F family of transcription factors. This protein regulates E2F-dependent transcriptional activation and cell proliferation, mainly through the E2F/retinoblastoma protein pathway. It also functions in the regulation of JUN oncogene expression. This protein shows distinctive nuclear-mitotic apparatus distribution, it is involved in spindle organization from prometaphase, and may also play a role as a midzone factor involved in chromosome segregation or cytokinesis. Two alternatively spliced transcript variants encoding the same protein have been noted for this gene. Two pseudogenes have also been identified on chromosome 1. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Cdca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Cdca4 APN 12 112821891 missense probably damaging 1.00
R1372:Cdca4 UTSW 12 112821917 nonsense probably null
R4450:Cdca4 UTSW 12 112821658 missense probably benign 0.02
R4835:Cdca4 UTSW 12 112821547 missense probably damaging 1.00
R5062:Cdca4 UTSW 12 112821863 missense probably benign 0.02
R5907:Cdca4 UTSW 12 112821719 missense probably benign 0.00
R7097:Cdca4 UTSW 12 112821569 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTTCTGAAAGCTTCCCCTG -3'
(R):5'- AGAGGGTTTTGGCACTGTCC -3'

Sequencing Primer
(F):5'- TGTCCATCTCCCAGAGGCTG -3'
(R):5'- GGCACTGTCCCTTCCTATAGC -3'
Posted On2015-07-07