Incidental Mutation 'R4410:Iqcg'
ID327881
Institutional Source Beutler Lab
Gene Symbol Iqcg
Ensembl Gene ENSMUSG00000035578
Gene NameIQ motif containing G
Synonyms
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33012683-33056218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33030816 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 262 (K262Q)
Ref Sequence ENSEMBL: ENSMUSP00000110752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115100]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect possibly damaging
Transcript: ENSMUST00000115100
AA Change: K262Q

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110752
Gene: ENSMUSG00000035578
AA Change: K262Q

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
coiled coil region 248 329 N/A INTRINSIC
IQ 371 393 1.54e-2 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231235
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Homozygous male mice are infertile and have very low epididymal sperm concentration with low motility, predominantly appearing as sperm heads without tails or with short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Iqcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Iqcg APN 16 33035600 missense possibly damaging 0.90
IGL01155:Iqcg APN 16 33040875 missense probably damaging 0.99
IGL01602:Iqcg APN 16 33016978 unclassified probably benign
IGL01605:Iqcg APN 16 33016978 unclassified probably benign
IGL02243:Iqcg APN 16 33045592 missense probably damaging 1.00
IGL02328:Iqcg APN 16 33019506 missense probably benign 0.00
IGL02490:Iqcg APN 16 33035567 nonsense probably null
IGL03297:Iqcg APN 16 33035632 splice site probably benign
R0038:Iqcg UTSW 16 33045642 missense probably benign 0.03
R0453:Iqcg UTSW 16 33049843 splice site probably benign
R0719:Iqcg UTSW 16 33040845 missense probably benign 0.26
R1191:Iqcg UTSW 16 33049943 missense probably benign 0.43
R1544:Iqcg UTSW 16 33045525 missense probably benign 0.01
R2292:Iqcg UTSW 16 33049883 missense probably benign 0.25
R3725:Iqcg UTSW 16 33020539 unclassified probably null
R3726:Iqcg UTSW 16 33029041 missense probably damaging 1.00
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3733:Iqcg UTSW 16 33053626 unclassified probably benign
R3734:Iqcg UTSW 16 33053626 unclassified probably benign
R3770:Iqcg UTSW 16 33050008 synonymous silent
R4296:Iqcg UTSW 16 33016975 unclassified probably benign
R4409:Iqcg UTSW 16 33045518 critical splice donor site probably null
R4429:Iqcg UTSW 16 33019490 missense probably benign 0.02
R4603:Iqcg UTSW 16 33040764 missense probably null 0.68
R4603:Iqcg UTSW 16 33040763 critical splice donor site probably null
R4979:Iqcg UTSW 16 33019514 missense probably damaging 1.00
R5672:Iqcg UTSW 16 33019508 missense probably damaging 0.99
R6183:Iqcg UTSW 16 33030923 missense probably damaging 1.00
R6965:Iqcg UTSW 16 33030804 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCATCAAATCATCTATCTACCCGAG -3'
(R):5'- TTGATGGCTAATCCTAACACAGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- AGGTACGCCTTCAGGAATTC -3'
Posted On2015-07-07