Incidental Mutation 'R4411:Pnpla7'
ID327891
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Namepatatin-like phospholipase domain containing 7
SynonymsNRE, E430013P11Rik
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24976033-25054057 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 25051704 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 13 (W13*)
Ref Sequence ENSEMBL: ENSMUSP00000115952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006646] [ENSMUST00000045295] [ENSMUST00000074422] [ENSMUST00000100334] [ENSMUST00000102931] [ENSMUST00000114386] [ENSMUST00000114388] [ENSMUST00000116574] [ENSMUST00000132172] [ENSMUST00000137913] [ENSMUST00000140737] [ENSMUST00000144520] [ENSMUST00000152122] [ENSMUST00000155601]
Predicted Effect probably benign
Transcript: ENSMUST00000006646
SMART Domains Protein: ENSMUSP00000006646
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 361 375 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045295
AA Change: W1146*
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: W1146*

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074422
SMART Domains Protein: ENSMUSP00000074022
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100334
SMART Domains Protein: ENSMUSP00000097908
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
low complexity region 363 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102931
SMART Domains Protein: ENSMUSP00000099995
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114386
SMART Domains Protein: ENSMUSP00000110028
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 310 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114388
SMART Domains Protein: ENSMUSP00000110030
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116574
SMART Domains Protein: ENSMUSP00000112273
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132082
Predicted Effect probably benign
Transcript: ENSMUST00000132172
SMART Domains Protein: ENSMUSP00000116106
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135328
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138536
Predicted Effect probably benign
Transcript: ENSMUST00000140737
SMART Domains Protein: ENSMUSP00000141410
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141866
Predicted Effect probably benign
Transcript: ENSMUST00000144520
SMART Domains Protein: ENSMUSP00000141583
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152122
SMART Domains Protein: ENSMUSP00000121580
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:IQ 62 80 2.5e-4 PFAM
low complexity region 114 125 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154359
Predicted Effect probably null
Transcript: ENSMUST00000155601
AA Change: W13*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175104
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24976315 critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24980224 missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 25016563 missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 25050893 missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 25050973 critical splice donor site probably null
IGL02280:Pnpla7 APN 2 25011577 missense probably benign 0.00
IGL02629:Pnpla7 APN 2 25050945 missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 25050276 missense probably benign 0.24
IGL02931:Pnpla7 APN 2 25015229 missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 25015289 unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 25042139 missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0309:Pnpla7 UTSW 2 24987195 missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24995293 missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 25052301 splice site probably null
R0565:Pnpla7 UTSW 2 24980117 splice site probably benign
R0830:Pnpla7 UTSW 2 24997255 missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24982123 missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24997240 missense probably damaging 1.00
R0969:Pnpla7 UTSW 2 25050953 missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24996165 missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 25047708 missense probably benign 0.01
R1572:Pnpla7 UTSW 2 25015251 missense possibly damaging 0.69
R1623:Pnpla7 UTSW 2 25052599 missense probably damaging 1.00
R1876:Pnpla7 UTSW 2 25040973 missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 25053784 unclassified probably benign
R1909:Pnpla7 UTSW 2 24997288 missense possibly damaging 0.75
R1973:Pnpla7 UTSW 2 25016617 missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 25051598 unclassified probably benign
R2381:Pnpla7 UTSW 2 24980758 missense probably damaging 1.00
R2655:Pnpla7 UTSW 2 25052318 missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 25042138 missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24982114 missense possibly damaging 0.69
R4573:Pnpla7 UTSW 2 25050873 missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 25052317 missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4842:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4893:Pnpla7 UTSW 2 25053676 nonsense probably null
R4941:Pnpla7 UTSW 2 24997264 unclassified probably null
R5116:Pnpla7 UTSW 2 25021970 missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24980044 missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 25041103 missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 25050309 missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24997300 missense probably benign 0.06
R5288:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 25021952 missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 25002937 missense probably benign 0.10
R5384:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 25019441 missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 25003001 missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 25052384 missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24981778 missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 25011649 missense probably benign
R6284:Pnpla7 UTSW 2 25016618 missense possibly damaging 0.79
R6351:Pnpla7 UTSW 2 25011564 missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 25016538 missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 25051615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTCCTGGAATGCTGCC -3'
(R):5'- TTAGTGTGCCACAAAACCCC -3'

Sequencing Primer
(F):5'- TGGAATGCTGCCCCATG -3'
(R):5'- TTGTCCCAGAGTTAGTCCCAGG -3'
Posted On2015-07-07