Incidental Mutation 'R0038:Agfg1'
ID32790
Institutional Source Beutler Lab
Gene Symbol Agfg1
Ensembl Gene ENSMUSG00000026159
Gene NameArfGAP with FG repeats 1
SynonymsC130049H11Rik, Rip, D730048C23Rik, Hrb
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0038 (G1)
Quality Score177
Status Validated (trace)
Chromosome1
Chromosomal Location82839483-82901182 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 82886102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063380] [ENSMUST00000113444] [ENSMUST00000186302] [ENSMUST00000187899] [ENSMUST00000189220] [ENSMUST00000190052]
Predicted Effect probably benign
Transcript: ENSMUST00000063380
SMART Domains Protein: ENSMUSP00000070250
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 9.31e-52 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.43e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 518 558 2.43e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113444
SMART Domains Protein: ENSMUSP00000109071
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.7e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.62e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 520 560 2.62e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000186302
SMART Domains Protein: ENSMUSP00000140785
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.62e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 520 560 2.62e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000187899
SMART Domains Protein: ENSMUSP00000139503
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 215 231 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
internal_repeat_1 375 410 6.63e-6 PROSPERO
low complexity region 412 425 N/A INTRINSIC
low complexity region 449 470 N/A INTRINSIC
internal_repeat_1 480 520 6.63e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000189220
SMART Domains Protein: ENSMUSP00000140170
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 9.31e-52 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.43e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 518 558 2.43e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000190046
Predicted Effect probably benign
Transcript: ENSMUST00000190052
SMART Domains Protein: ENSMUSP00000141157
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 215 231 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
internal_repeat_1 375 410 2.33e-5 PROSPERO
low complexity region 465 486 N/A INTRINSIC
internal_repeat_1 496 536 2.33e-5 PROSPERO
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Male mice homozygous for disruptions in this gene are infertile as a result of abnormalities in spermatogenesis. Otherwise, males and females are normal and live a normal life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Agfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Agfg1 APN 1 82858403 missense probably damaging 1.00
IGL02066:Agfg1 APN 1 82893558 missense probably damaging 1.00
IGL02447:Agfg1 APN 1 82882223 splice site probably benign
R0038:Agfg1 UTSW 1 82886102 splice site probably benign
R0548:Agfg1 UTSW 1 82886431 missense probably damaging 0.97
R0962:Agfg1 UTSW 1 82886396 missense probably damaging 1.00
R1213:Agfg1 UTSW 1 82875334 missense probably damaging 1.00
R1638:Agfg1 UTSW 1 82893538 missense probably damaging 1.00
R4078:Agfg1 UTSW 1 82882287 missense possibly damaging 0.94
R4477:Agfg1 UTSW 1 82875340 missense probably damaging 1.00
R4780:Agfg1 UTSW 1 82886387 missense probably damaging 1.00
R5103:Agfg1 UTSW 1 82893567 missense probably damaging 1.00
R5576:Agfg1 UTSW 1 82870724 missense probably benign 0.01
R5663:Agfg1 UTSW 1 82893452 missense probably damaging 1.00
R6314:Agfg1 UTSW 1 82858434 missense probably damaging 1.00
R6699:Agfg1 UTSW 1 82858454 splice site probably null
R7266:Agfg1 UTSW 1 82882245 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAACTTGTaattgaggctttcaagca -3'
(R):5'- GGACCAGTAGCAGCAACAAATGGAT -3'

Sequencing Primer
(F):5'- gttcatcagtttcagtttcccc -3'
(R):5'- TGGATTCGTAGAAGGCGTAGC -3'
Posted On2013-05-09