Incidental Mutation 'R4411:Npr3'
ID327937
Institutional Source Beutler Lab
Gene Symbol Npr3
Ensembl Gene ENSMUSG00000022206
Gene Namenatriuretic peptide receptor 3
Synonymslongjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R4411 (G1)
Quality Score186
Status Validated
Chromosome15
Chromosomal Location11839896-11907287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 11905149 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 164 (T164R)
Ref Sequence ENSEMBL: ENSMUSP00000066737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]
Predicted Effect probably benign
Transcript: ENSMUST00000066529
AA Change: T164R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: T164R

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:ANF_receptor 66 417 1e-59 PFAM
transmembrane domain 477 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227557
Predicted Effect probably benign
Transcript: ENSMUST00000228489
Predicted Effect probably benign
Transcript: ENSMUST00000228603
AA Change: T164R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.1428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Npr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Npr3 APN 15 11895694 missense probably damaging 1.00
IGL01420:Npr3 APN 15 11858632 missense probably damaging 1.00
IGL01599:Npr3 APN 15 11895789 missense probably damaging 1.00
IGL01977:Npr3 APN 15 11858718 missense probably damaging 1.00
eel UTSW 15 11858647 missense probably damaging 0.99
R0581:Npr3 UTSW 15 11851450 missense probably damaging 0.99
R0607:Npr3 UTSW 15 11845282 missense probably benign 0.32
R1554:Npr3 UTSW 15 11848563 missense probably benign
R1779:Npr3 UTSW 15 11851486 missense probably damaging 1.00
R1793:Npr3 UTSW 15 11848579 missense probably benign 0.05
R1968:Npr3 UTSW 15 11904969 missense probably benign 0.31
R2379:Npr3 UTSW 15 11883363 missense probably damaging 0.99
R2883:Npr3 UTSW 15 11883324 missense possibly damaging 0.50
R3080:Npr3 UTSW 15 11905149 missense probably benign 0.01
R3745:Npr3 UTSW 15 11905491 missense probably damaging 1.00
R3803:Npr3 UTSW 15 11895790 missense probably damaging 1.00
R4166:Npr3 UTSW 15 11848513 missense probably benign 0.32
R4412:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4667:Npr3 UTSW 15 11905467 missense possibly damaging 0.58
R5209:Npr3 UTSW 15 11848603 missense possibly damaging 0.73
R5742:Npr3 UTSW 15 11883408 missense probably damaging 1.00
R6339:Npr3 UTSW 15 11845275 missense probably damaging 0.99
R6605:Npr3 UTSW 15 11905432 missense probably damaging 1.00
R6890:Npr3 UTSW 15 11883392 missense possibly damaging 0.89
S24628:Npr3 UTSW 15 11848563 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTCCAGGTCCAAGTCTTTG -3'
(R):5'- TCTTCAGTCTTGTGGACCGC -3'

Sequencing Primer
(F):5'- TCTCGTCGAAATTGTAGGCAGAC -3'
(R):5'- TCTTGTGGACCGCGTGGC -3'
Posted On2015-07-07