Mutagenetix > Incidental Mutations

Incidental Mutation 'R4411:Npr3'

327937

Institutional Source

Beutler Lab

Gene Symbol

Npr3

Ensembl Gene

ENSMUSG00000022206

Gene Name

natriuretic peptide receptor 3

Synonyms

longjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj

MMRRC Submission

041693-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.577) question?

Stock #

R4411 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

11839896-11907287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 11905149 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Arginine at position 164 (T164R)

Ref Sequence

ENSEMBL: ENSMUSP00000066737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]

Predicted Effect

probably benign
Transcript: ENSMUST00000066529
AA Change: T164R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: T164R

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:ANF_receptor	66	417	1e-59	PFAM
transmembrane domain	477	499	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227557

Predicted Effect

probably benign
Transcript: ENSMUST00000228489

Predicted Effect

probably benign
Transcript: ENSMUST00000228603
AA Change: T164R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.1428

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,151,955	I423V	probably benign	Het
Abl2	T	C	1: 156,630,082	V306A	possibly damaging	Het
Adcy4	T	C	14: 55,769,443	Y1006C	probably damaging	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Arid5b	T	C	10: 68,096,689	R885G	probably damaging	Het
Atp9a	A	T	2: 168,661,933	V613E	probably damaging	Het
Atxn7l1	G	T	12: 33,194,887		probably benign	Het
Brd8	C	A	18: 34,623,444		probably benign	Het
Bsnd	C	T	4: 106,486,671	R146H	probably benign	Het
C4b	C	T	17: 34,728,864	R1659H	probably damaging	Het
Duox1	G	A	2: 122,337,634	R1080H	probably benign	Het
Eml2	T	C	7: 19,182,401		probably null	Het
Fbxo44	G	A	4: 148,153,608	R221C	probably damaging	Het
Frem1	T	C	4: 82,963,244	D166G	probably damaging	Het
Galnt5	T	C	2: 57,999,195	L269P	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Gpc6	T	C	14: 117,951,178	V408A	probably benign	Het
Hspg2	A	G	4: 137,562,224	T3832A	probably benign	Het
Ift88	A	G	14: 57,477,979	N493S	probably damaging	Het
Ighv1-76	A	T	12: 115,848,111	C41S	probably damaging	Het
Igkv12-46	G	A	6: 69,764,946	T16I	probably benign	Het
Igkv3-9	G	T	6: 70,588,563	V49F	probably damaging	Het
Isoc2b	A	T	7: 4,849,434		probably benign	Het
Lcp2	T	A	11: 34,087,173		probably benign	Het
Lmntd1	A	G	6: 145,427,277		probably null	Het
Mdm2	A	T	10: 117,709,789		probably null	Het
Mrgprx3-ps	T	C	7: 47,309,998		noncoding transcript	Het
Msh2	T	C	17: 87,717,604	S637P	probably damaging	Het
Myo5b	T	C	18: 74,698,274	F765S	possibly damaging	Het
Nav2	T	A	7: 49,398,109	N91K	probably benign	Het
Ndor1	G	A	2: 25,248,480	P363S	probably benign	Het
Pcdhb5	T	C	18: 37,321,997	S477P	possibly damaging	Het
Pde3b	GTGATGATGATGATGATGATGATGATG	GTGATGATGATGATGATGATGATG	7: 114,534,749		probably benign	Het
Pnpla7	G	A	2: 25,051,704	W13*	probably null	Het
Pnpla8	T	C	12: 44,283,442	V41A	probably benign	Het
Prdm2	A	T	4: 143,133,670	S1017T	probably benign	Het
Prdm5	T	A	6: 65,901,787	Y108*	probably null	Het
Rab34	T	A	11: 78,188,766		probably null	Het
Smpd5	G	T	15: 76,294,912	R160L	possibly damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Taf5	T	A	19: 47,071,014	V199D	probably damaging	Het
Tas2r114	C	T	6: 131,689,622	V148I	probably benign	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tex43	A	G	18: 56,594,648	T65A	probably benign	Het
Tnfrsf25	G	A	4: 152,118,386		probably benign	Het
Tpd52l1	T	C	10: 31,379,319	T11A	possibly damaging	Het
Trmt1l	G	A	1: 151,452,154	E472K	probably benign	Het
Ttc17	T	C	2: 94,342,753	K766E	probably damaging	Het
Ttc37	A	G	13: 76,127,504	E410G	possibly damaging	Het
Ttn	C	T	2: 76,730,289	R29256Q	probably damaging	Het
Ttn	T	C	2: 76,742,070	I26160V	probably damaging	Het
Ubxn6	A	T	17: 56,069,303	V311E	probably damaging	Het
Usp2	T	C	9: 44,091,063	S351P	probably damaging	Het
Usp7	C	A	16: 8,708,914	D187Y	probably damaging	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Vmn2r58	T	A	7: 41,861,936	K481M	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Zfp455	A	T	13: 67,207,325	N219I	probably damaging	Het

Other mutations in Npr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Npr3	APN	15	11895694	missense	probably damaging	1.00
IGL01420:Npr3	APN	15	11858632	missense	probably damaging	1.00
IGL01599:Npr3	APN	15	11895789	missense	probably damaging	1.00
IGL01977:Npr3	APN	15	11858718	missense	probably damaging	1.00
eel	UTSW	15	11858647	missense	probably damaging	0.99
R0581:Npr3	UTSW	15	11851450	missense	probably damaging	0.99
R0607:Npr3	UTSW	15	11845282	missense	probably benign	0.32
R1554:Npr3	UTSW	15	11848563	missense	probably benign
R1779:Npr3	UTSW	15	11851486	missense	probably damaging	1.00
R1793:Npr3	UTSW	15	11848579	missense	probably benign	0.05
R1968:Npr3	UTSW	15	11904969	missense	probably benign	0.31
R2379:Npr3	UTSW	15	11883363	missense	probably damaging	0.99
R2883:Npr3	UTSW	15	11883324	missense	possibly damaging	0.50
R3080:Npr3	UTSW	15	11905149	missense	probably benign	0.01
R3745:Npr3	UTSW	15	11905491	missense	probably damaging	1.00
R3803:Npr3	UTSW	15	11895790	missense	probably damaging	1.00
R4166:Npr3	UTSW	15	11848513	missense	probably benign	0.32
R4412:Npr3	UTSW	15	11905149	missense	probably benign	0.01
R4667:Npr3	UTSW	15	11905467	missense	possibly damaging	0.58
R5209:Npr3	UTSW	15	11848603	missense	possibly damaging	0.73
R5742:Npr3	UTSW	15	11883408	missense	probably damaging	1.00
R6339:Npr3	UTSW	15	11845275	missense	probably damaging	0.99
R6605:Npr3	UTSW	15	11905432	missense	probably damaging	1.00
R6890:Npr3	UTSW	15	11883392	missense	possibly damaging	0.89
S24628:Npr3	UTSW	15	11848563	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCGTCCAGGTCCAAGTCTTTG -3'
(R):5'- TCTTCAGTCTTGTGGACCGC -3'

Sequencing Primer
(F):5'- TCTCGTCGAAATTGTAGGCAGAC -3'
(R):5'- TCTTGTGGACCGCGTGGC -3'

Posted On

2015-07-07