Incidental Mutation 'R4411:Taf5'
ID327948
Institutional Source Beutler Lab
Gene Symbol Taf5
Ensembl Gene ENSMUSG00000025049
Gene NameTATA-box binding protein associated factor 5
Synonyms6330528C20Rik
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47067748-47083479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47071014 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 199 (V199D)
Ref Sequence ENSEMBL: ENSMUSP00000026027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026027]
Predicted Effect probably damaging
Transcript: ENSMUST00000026027
AA Change: V199D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026027
Gene: ENSMUSG00000025049
AA Change: V199D

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 29 92 N/A INTRINSIC
LisH 93 125 6.52e-2 SMART
low complexity region 132 150 N/A INTRINSIC
Pfam:TFIID_NTD2 206 338 4.5e-55 PFAM
low complexity region 389 417 N/A INTRINSIC
WD40 460 499 8.36e-2 SMART
WD40 533 572 1.82e-11 SMART
WD40 575 614 1.19e-6 SMART
WD40 617 656 9.08e-12 SMART
WD40 659 698 1.4e-12 SMART
WD40 701 740 2.57e-11 SMART
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Taf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Taf5 APN 19 47082301 missense probably damaging 1.00
IGL01115:Taf5 APN 19 47075082 missense probably benign 0.01
IGL02168:Taf5 APN 19 47082478 missense probably damaging 0.98
IGL02638:Taf5 APN 19 47068210 missense probably benign 0.00
IGL02689:Taf5 APN 19 47077265 splice site probably benign
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0220:Taf5 UTSW 19 47080560 missense probably damaging 1.00
R0685:Taf5 UTSW 19 47074854 missense probably benign 0.10
R1518:Taf5 UTSW 19 47081846 missense probably damaging 1.00
R2329:Taf5 UTSW 19 47075124 missense probably benign 0.07
R3431:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3432:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3689:Taf5 UTSW 19 47078785 missense probably damaging 0.99
R4413:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4676:Taf5 UTSW 19 47074970 missense probably damaging 1.00
R5370:Taf5 UTSW 19 47075764 missense probably damaging 0.99
R5875:Taf5 UTSW 19 47076110 missense probably damaging 1.00
R5883:Taf5 UTSW 19 47067789 missense unknown
R5937:Taf5 UTSW 19 47081895 missense probably damaging 1.00
R6835:Taf5 UTSW 19 47077337 missense possibly damaging 0.94
R7007:Taf5 UTSW 19 47071211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCTAGCCTCATCACAG -3'
(R):5'- CCAAGGCACCTGTCCTTCTG -3'

Sequencing Primer
(F):5'- AAGGAAAAGATGCGTGGTTGTGTTG -3'
(R):5'- AAGGCACCTGTCCTTCTGATTTAC -3'
Posted On2015-07-07