Incidental Mutation 'R4412:Ilf3'
ID327973
Institutional Source Beutler Lab
Gene Symbol Ilf3
Ensembl Gene ENSMUSG00000032178
Gene Nameinterleukin enhancer binding factor 3
SynonymsNF90
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21367871-21405361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21399560 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 620 (P620S)
Ref Sequence ENSEMBL: ENSMUSP00000150280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067646] [ENSMUST00000115414] [ENSMUST00000213518] [ENSMUST00000213603] [ENSMUST00000214758] [ENSMUST00000216892] [ENSMUST00000217348]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067646
AA Change: P607S

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065770
Gene: ENSMUSG00000032178
AA Change: P607S

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
low complexity region 691 725 N/A INTRINSIC
low complexity region 745 769 N/A INTRINSIC
low complexity region 777 807 N/A INTRINSIC
low complexity region 810 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115414
AA Change: P607S

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111074
Gene: ENSMUSG00000032178
AA Change: P607S

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213518
AA Change: P620S

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213603
AA Change: P620S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214217
Predicted Effect possibly damaging
Transcript: ENSMUST00000214758
AA Change: P620S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000214821
Predicted Effect probably benign
Transcript: ENSMUST00000215169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215438
Predicted Effect probably benign
Transcript: ENSMUST00000216892
AA Change: P620S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217348
AA Change: P82S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000217498
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains two double-stranded RNA binding domains and functions in the post-transcriptional regulation of gene expression. It is a component of an RNA-protein complex that may be involved in mediating the export of messenger RNAs. Alternative splicing results in multiple transcript variants encoding distinct isoforms. These isoforms are grouped into two categories, NFAR-1 or NFAR-2, based on variation at the C-terminus. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are born small and weak, show tachypnea and multi-organ apoptosis, and die neonatally due to neuromuscular respiratory failure. The diaphragm and other skeletal muscles show disorganization and paucity of myofibers,myocyte degeneration and elevated apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Ilf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ilf3 APN 9 21396051 missense probably damaging 1.00
IGL01013:Ilf3 APN 9 21399691 missense possibly damaging 0.91
IGL01352:Ilf3 APN 9 21392322 missense possibly damaging 0.89
IGL01975:Ilf3 APN 9 21392379 missense probably benign 0.03
IGL02826:Ilf3 APN 9 21398044 missense probably benign 0.20
IGL03238:Ilf3 APN 9 21392350 missense probably damaging 1.00
PIT4466001:Ilf3 UTSW 9 21403366 missense unknown
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0090:Ilf3 UTSW 9 21395414 missense probably damaging 1.00
R0355:Ilf3 UTSW 9 21397970 missense probably damaging 1.00
R1768:Ilf3 UTSW 9 21403142 unclassified probably benign
R1889:Ilf3 UTSW 9 21404767 unclassified probably benign
R1895:Ilf3 UTSW 9 21404767 unclassified probably benign
R1918:Ilf3 UTSW 9 21393714 missense probably damaging 1.00
R2930:Ilf3 UTSW 9 21399590 missense possibly damaging 0.91
R3912:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R3913:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R4080:Ilf3 UTSW 9 21403134 critical splice acceptor site probably null
R4510:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R4511:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R5201:Ilf3 UTSW 9 21389383 missense probably damaging 1.00
R5785:Ilf3 UTSW 9 21394872 missense probably damaging 1.00
R6303:Ilf3 UTSW 9 21403136 unclassified probably benign
R6406:Ilf3 UTSW 9 21396244 missense probably damaging 0.99
R6434:Ilf3 UTSW 9 21403151 unclassified probably benign
R7169:Ilf3 UTSW 9 21395426 missense probably damaging 0.96
X0066:Ilf3 UTSW 9 21392406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAAGGCTTTGGGGATAG -3'
(R):5'- GCACTTCATTATGCATGGGG -3'

Sequencing Primer
(F):5'- GGGTTAGTTCAGCCCCTACACAC -3'
(R):5'- CATTATGCATGGGGCCTCC -3'
Posted On2015-07-07