Incidental Mutation 'R4412:Gsdmc3'
ID327986
Institutional Source Beutler Lab
Gene Symbol Gsdmc3
Ensembl Gene ENSMUSG00000055827
Gene Namegasdermin C3
Synonyms9930109F21Rik
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location63857724-63878558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63866796 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 139 (M139T)
Ref Sequence ENSEMBL: ENSMUSP00000139472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089894] [ENSMUST00000185526] [ENSMUST00000190682]
Predicted Effect probably benign
Transcript: ENSMUST00000089894
AA Change: M139T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087339
Gene: ENSMUSG00000055827
AA Change: M139T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 2.1e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185526
AA Change: M139T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140272
Gene: ENSMUSG00000055827
AA Change: M139T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190682
AA Change: M139T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139472
Gene: ENSMUSG00000055827
AA Change: M139T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Gsdmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gsdmc3 APN 15 63859677 missense probably benign 0.05
IGL01125:Gsdmc3 APN 15 63861457 missense probably benign 0.09
R0490:Gsdmc3 UTSW 15 63860250 missense possibly damaging 0.88
R0620:Gsdmc3 UTSW 15 63859693 missense probably damaging 1.00
R0932:Gsdmc3 UTSW 15 63858551 critical splice acceptor site probably null
R1298:Gsdmc3 UTSW 15 63860281 missense probably damaging 0.99
R1378:Gsdmc3 UTSW 15 63859586 splice site probably benign
R1815:Gsdmc3 UTSW 15 63869116 missense probably damaging 1.00
R1962:Gsdmc3 UTSW 15 63858466 missense probably damaging 1.00
R1965:Gsdmc3 UTSW 15 63858447 missense probably damaging 1.00
R2088:Gsdmc3 UTSW 15 63860214 critical splice donor site probably null
R2090:Gsdmc3 UTSW 15 63866782 missense probably benign 0.07
R2126:Gsdmc3 UTSW 15 63858534 nonsense probably null
R2276:Gsdmc3 UTSW 15 63860256 missense probably benign 0.09
R4913:Gsdmc3 UTSW 15 63858273 makesense probably null
R5241:Gsdmc3 UTSW 15 63864146 missense possibly damaging 0.96
R6016:Gsdmc3 UTSW 15 63868412 missense probably benign 0.07
R6026:Gsdmc3 UTSW 15 63866751 missense probably damaging 1.00
R6291:Gsdmc3 UTSW 15 63860241 missense probably benign 0.00
R6698:Gsdmc3 UTSW 15 63860271 missense possibly damaging 0.94
R7316:Gsdmc3 UTSW 15 63858402 missense possibly damaging 0.81
R7566:Gsdmc3 UTSW 15 63861661 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGAAAGCGATCCCCAGAATC -3'
(R):5'- CACGTGTACCATGTTATCAACTTC -3'

Sequencing Primer
(F):5'- CCTAAGAAGCAAGAGTACACTAGCTG -3'
(R):5'- TTATTGACTGAGGAACGTCCCCAG -3'
Posted On2015-07-07