Incidental Mutation 'R4413:Plekhg3'
ID328029
Institutional Source Beutler Lab
Gene Symbol Plekhg3
Ensembl Gene ENSMUSG00000052609
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 3
SynonymsMGC40768
MMRRC Submission 041136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4413 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76530891-76580488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76577764 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1127 (T1127P)
Ref Sequence ENSEMBL: ENSMUSP00000151851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000075249] [ENSMUST00000219063]
Predicted Effect probably benign
Transcript: ENSMUST00000021458
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075249
AA Change: T1128P

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609
AA Change: T1128P

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
RhoGEF 97 271 6.67e-51 SMART
PH 297 396 2.48e-9 SMART
coiled coil region 515 552 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 978 993 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218427
Predicted Effect probably damaging
Transcript: ENSMUST00000219063
AA Change: T1127P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219426
Meta Mutation Damage Score 0.1872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Exoc1 A G 5: 76,542,019 probably benign Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Mrm1 G T 11: 84,819,228 R49S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syn3 C A 10: 86,055,592 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 V402E probably damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Plekhg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Plekhg3 APN 12 76562278 missense probably damaging 0.99
IGL01143:Plekhg3 APN 12 76564982 critical splice donor site probably null
IGL02079:Plekhg3 APN 12 76560429 missense probably benign 0.01
IGL02349:Plekhg3 APN 12 76562300 missense probably damaging 1.00
IGL02442:Plekhg3 APN 12 76578353 missense probably benign 0.01
IGL02570:Plekhg3 APN 12 76578245 missense probably benign
flagging UTSW 12 76560520 critical splice donor site probably null
trailing UTSW 12 76564961 missense probably benign 0.15
R0344:Plekhg3 UTSW 12 76566266 nonsense probably null
R0667:Plekhg3 UTSW 12 76576598 missense probably damaging 1.00
R1269:Plekhg3 UTSW 12 76560469 missense probably damaging 1.00
R1566:Plekhg3 UTSW 12 76572065 missense possibly damaging 0.54
R1905:Plekhg3 UTSW 12 76576217 missense probably benign 0.05
R2885:Plekhg3 UTSW 12 76564961 missense probably benign 0.15
R2962:Plekhg3 UTSW 12 76572659 critical splice donor site probably null
R3784:Plekhg3 UTSW 12 76560520 critical splice donor site probably null
R3941:Plekhg3 UTSW 12 76573359 missense probably damaging 0.98
R4056:Plekhg3 UTSW 12 76565247 missense probably damaging 1.00
R4080:Plekhg3 UTSW 12 76577981 missense probably benign 0.02
R4412:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4704:Plekhg3 UTSW 12 76578238 missense probably damaging 1.00
R4720:Plekhg3 UTSW 12 76578322 missense possibly damaging 0.59
R4738:Plekhg3 UTSW 12 76576914 missense probably damaging 1.00
R4898:Plekhg3 UTSW 12 76564125 missense probably damaging 1.00
R4994:Plekhg3 UTSW 12 76565537 missense possibly damaging 0.68
R4999:Plekhg3 UTSW 12 76565247 missense possibly damaging 0.95
R5484:Plekhg3 UTSW 12 76578400 missense possibly damaging 0.76
R5591:Plekhg3 UTSW 12 76560292 missense possibly damaging 0.80
R6019:Plekhg3 UTSW 12 76577941 nonsense probably null
R6147:Plekhg3 UTSW 12 76565211 missense probably damaging 0.96
R6272:Plekhg3 UTSW 12 76576845 missense probably benign 0.00
R6482:Plekhg3 UTSW 12 76576004 missense probably benign 0.01
R7081:Plekhg3 UTSW 12 76578245 missense probably benign
X0062:Plekhg3 UTSW 12 76573343 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCTCAAATGGGATTTCTCTTCC -3'
(R):5'- TCTCGACCTGAGCAGTCTTGTC -3'

Sequencing Primer
(F):5'- CAAATGGGATTTCTCTTCCAGCATAC -3'
(R):5'- AGCAGTCTTGTCGTGGGAAG -3'
Posted On2015-07-07