Incidental Mutation 'R4414:Obsl1'
ID328043
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75490902 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1409 (D1409E)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113567]
Predicted Effect probably benign
Transcript: ENSMUST00000113567
AA Change: D1409E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: D1409E

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132252
AA Change: D399E
SMART Domains Protein: ENSMUSP00000117420
Gene: ENSMUSG00000026211
AA Change: D399E

DomainStartEndE-ValueType
IG_like 1 59 2.8e-1 SMART
IGc2 85 151 9.49e-5 SMART
IG 175 254 2.64e-3 SMART
IG 265 344 7.41e-7 SMART
Blast:IG 354 417 4e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154636
Predicted Effect probably benign
Transcript: ENSMUST00000155084
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156705
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
PIT4382001:Obsl1 UTSW 1 75487963 missense probably benign 0.06
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1864:Obsl1 UTSW 1 75493109 missense probably benign 0.01
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2069:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2184:Obsl1 UTSW 1 75502217 missense probably benign 0.26
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5757:Obsl1 UTSW 1 75493055 missense probably damaging 0.98
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 unclassified probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense probably benign
R7123:Obsl1 UTSW 1 75489669 missense probably damaging 1.00
R7202:Obsl1 UTSW 1 75489716 missense possibly damaging 0.94
R7291:Obsl1 UTSW 1 75489517 missense probably damaging 0.98
R7305:Obsl1 UTSW 1 75493946 nonsense probably null
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTCAGCAGAAAGGAGCAC -3'
(R):5'- AACCTCTGGGCTCCATGATC -3'

Sequencing Primer
(F):5'- CACTTTGGTGGTGGTGGCAG -3'
(R):5'- TCATCTTCCCTTCCAGAGACAGAG -3'
Posted On2015-07-07