Incidental Mutation 'R4414:Mlxipl'
ID328059
Institutional Source Beutler Lab
Gene Symbol Mlxipl
Ensembl Gene ENSMUSG00000005373
Gene NameMLX interacting protein-like
SynonymsWS-bHLH, Wbscr14, bHLHd14, ChREBP
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R4414 (G1)
Quality Score191
Status Validated
Chromosome5
Chromosomal Location135089890-135138382 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 135137399 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]
Predicted Effect probably benign
Transcript: ENSMUST00000005507
SMART Domains Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 1e-8 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
HLH 667 721 1.14e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123370
SMART Domains Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 19 73 1.14e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128691
SMART Domains Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1hloa_ 658 709 6e-7 SMART
Blast:HLH 667 699 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129008
SMART Domains Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142385
SMART Domains Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153519
SMART Domains Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1am9a_ 658 696 1e-5 SMART
Blast:HLH 667 698 2e-12 BLAST
low complexity region 728 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154840
SMART Domains Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 26 120 7.9e-4 SMART
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Mlxipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Mlxipl APN 5 135132778 missense probably damaging 0.98
IGL01872:Mlxipl APN 5 135113691 missense probably damaging 1.00
IGL02694:Mlxipl APN 5 135124018 critical splice donor site probably null
IGL03070:Mlxipl APN 5 135132453 missense possibly damaging 0.93
Scarlet UTSW 5 135134030 missense possibly damaging 0.93
H8441:Mlxipl UTSW 5 135123961 missense probably damaging 1.00
IGL03054:Mlxipl UTSW 5 135133256 missense possibly damaging 0.83
R0003:Mlxipl UTSW 5 135133189 unclassified probably benign
R0126:Mlxipl UTSW 5 135132323 missense probably damaging 0.96
R0458:Mlxipl UTSW 5 135133370 missense probably benign 0.33
R0513:Mlxipl UTSW 5 135137263 missense probably benign 0.33
R0580:Mlxipl UTSW 5 135123975 missense probably benign 0.01
R0744:Mlxipl UTSW 5 135132475 missense possibly damaging 0.86
R0827:Mlxipl UTSW 5 135132738 missense probably benign 0.00
R1052:Mlxipl UTSW 5 135113710 missense probably damaging 1.00
R1241:Mlxipl UTSW 5 135132718 missense probably benign 0.01
R1795:Mlxipl UTSW 5 135107170 missense probably damaging 1.00
R1903:Mlxipl UTSW 5 135133568 missense possibly damaging 0.92
R2038:Mlxipl UTSW 5 135106999 missense probably damaging 1.00
R2064:Mlxipl UTSW 5 135132777 missense possibly damaging 0.77
R2069:Mlxipl UTSW 5 135107005 missense probably damaging 1.00
R2081:Mlxipl UTSW 5 135113638 missense probably damaging 1.00
R2095:Mlxipl UTSW 5 135122120 splice site probably benign
R3114:Mlxipl UTSW 5 135133662 splice site probably benign
R4018:Mlxipl UTSW 5 135132672 missense probably damaging 1.00
R4090:Mlxipl UTSW 5 135132527 missense probably benign 0.33
R4321:Mlxipl UTSW 5 135135450 nonsense probably null
R5706:Mlxipl UTSW 5 135133604 missense probably benign 0.33
R6088:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R6508:Mlxipl UTSW 5 135128620 missense probably benign 0.03
R6704:Mlxipl UTSW 5 135137240 critical splice acceptor site probably null
R7060:Mlxipl UTSW 5 135132315 missense possibly damaging 0.88
R7095:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R7128:Mlxipl UTSW 5 135133851 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCATCCCTAACTGTAAAGACGTC -3'
(R):5'- GGCCCTCTGTTATTAAAGGGAG -3'

Sequencing Primer
(F):5'- CAGAGGTTCAGTCCATTATCAAGGC -3'
(R):5'- CTCTGTTATTAAAGGGAGGTCCAAAG -3'
Posted On2015-07-07