Incidental Mutation 'R4414:Cep89'
ID328065
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Namecentrosomal protein 89
SynonymsCcdc123, 2610507L03Rik
MMRRC Submission 041694-MU
Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35397035-35438689 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 35416397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141704
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155137
Predicted Effect probably benign
Transcript: ENSMUST00000206230
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35405707 missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35420900 missense probably damaging 1.00
IGL02001:Cep89 APN 7 35403007 splice site probably benign
IGL02141:Cep89 APN 7 35420924 missense probably damaging 1.00
IGL02468:Cep89 APN 7 35403152 missense probably benign 0.35
IGL02507:Cep89 APN 7 35435565 missense probably damaging 1.00
IGL02612:Cep89 APN 7 35424655 critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35424653 intron probably benign
IGL03396:Cep89 APN 7 35429178 missense probably benign 0.05
3-1:Cep89 UTSW 7 35424722 missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35409641 utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35409641 utr 3 prime probably benign
K2124:Cep89 UTSW 7 35420972 splice site probably benign
R0127:Cep89 UTSW 7 35428262 missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35416402 unclassified probably benign
R0609:Cep89 UTSW 7 35435530 missense probably damaging 1.00
R1442:Cep89 UTSW 7 35418211 splice site probably benign
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1661:Cep89 UTSW 7 35417680 missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35438383 missense probably damaging 1.00
R4700:Cep89 UTSW 7 35438437 missense probably benign 0.05
R4963:Cep89 UTSW 7 35403152 missense probably benign 0.35
R4968:Cep89 UTSW 7 35409630 missense possibly damaging 0.90
R4972:Cep89 UTSW 7 35432552 missense probably damaging 1.00
R5578:Cep89 UTSW 7 35409642 unclassified probably benign
R5767:Cep89 UTSW 7 35417645 missense probably damaging 1.00
R5809:Cep89 UTSW 7 35417726 missense probably damaging 0.97
R5890:Cep89 UTSW 7 35429162 missense probably damaging 0.99
R6290:Cep89 UTSW 7 35420263 missense probably damaging 1.00
R6361:Cep89 UTSW 7 35398047 missense probably damaging 1.00
R6627:Cep89 UTSW 7 35427747 missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35438463 missense probably benign 0.03
V7732:Cep89 UTSW 7 35403098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCACTGCACACTTAGGC -3'
(R):5'- GCTAGTCACAGCATCAGACC -3'

Sequencing Primer
(F):5'- ACACTTAGGCCCGGAGAG -3'
(R):5'- CCCAGAGCCTTCACAGGGAG -3'
Posted On2015-07-07