Incidental Mutation 'R4425:Tpo'
ID328122
Institutional Source Beutler Lab
Gene Symbol Tpo
Ensembl Gene ENSMUSG00000020673
Gene Namethyroid peroxidase
Synonyms
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R4425 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location30054659-30132624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30104016 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 230 (Y230C)
Ref Sequence ENSEMBL: ENSMUSP00000021005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021005]
Predicted Effect probably damaging
Transcript: ENSMUST00000021005
AA Change: Y230C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: Y230C

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:An_peroxidase 145 697 4.2e-180 PFAM
CCP 730 782 1.26e-7 SMART
EGF_CA 784 827 3.51e-10 SMART
transmembrane domain 837 859 N/A INTRINSIC
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Tpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tpo APN 12 30084620 missense probably damaging 1.00
IGL00694:Tpo APN 12 30105994 missense probably damaging 0.98
IGL01660:Tpo APN 12 30119400 splice site probably benign
IGL01939:Tpo APN 12 30084647 missense possibly damaging 0.83
IGL02624:Tpo APN 12 30100414 missense probably benign 0.40
IGL03268:Tpo APN 12 30094965 missense possibly damaging 0.82
IGL03330:Tpo APN 12 30103501 missense probably damaging 0.97
IGL03138:Tpo UTSW 12 30074171 missense probably benign 0.00
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0076:Tpo UTSW 12 30104023 missense probably damaging 1.00
R0472:Tpo UTSW 12 30100486 missense probably benign 0.03
R1389:Tpo UTSW 12 30103110 missense probably damaging 0.98
R1493:Tpo UTSW 12 30131809 missense possibly damaging 0.78
R1526:Tpo UTSW 12 30084695 missense probably damaging 0.99
R1674:Tpo UTSW 12 30100568 missense probably benign 0.16
R1689:Tpo UTSW 12 30098246 missense probably damaging 1.00
R1986:Tpo UTSW 12 30119466 missense probably damaging 1.00
R2381:Tpo UTSW 12 30131827 missense possibly damaging 0.67
R2484:Tpo UTSW 12 30103969 missense probably benign 0.12
R2902:Tpo UTSW 12 30119449 missense possibly damaging 0.91
R4105:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4106:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4107:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4108:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4109:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4374:Tpo UTSW 12 30103152 missense possibly damaging 0.50
R4600:Tpo UTSW 12 30098229 missense probably benign 0.32
R4668:Tpo UTSW 12 30103290 missense probably benign 0.03
R4758:Tpo UTSW 12 30075871 missense probably damaging 1.00
R4838:Tpo UTSW 12 30092634 missense probably damaging 1.00
R4869:Tpo UTSW 12 30103365 missense probably benign 0.00
R5163:Tpo UTSW 12 30105980 missense probably benign 0.00
R5223:Tpo UTSW 12 30092590 missense probably damaging 0.99
R5367:Tpo UTSW 12 30103290 missense probably damaging 1.00
R5658:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R5660:Tpo UTSW 12 30100496 missense possibly damaging 0.92
R5671:Tpo UTSW 12 30119491 missense probably benign 0.00
R6019:Tpo UTSW 12 30094981 missense possibly damaging 0.94
R6074:Tpo UTSW 12 30078187 missense probably benign 0.15
R6181:Tpo UTSW 12 30131885 missense probably benign 0.37
R6321:Tpo UTSW 12 30103108 missense probably damaging 1.00
R6433:Tpo UTSW 12 30084754 missense probably benign
R7206:Tpo UTSW 12 30103134 missense possibly damaging 0.76
R7234:Tpo UTSW 12 30092686 missense probably benign 0.00
X0050:Tpo UTSW 12 30078094 missense probably damaging 1.00
Z1088:Tpo UTSW 12 30094782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAAAGCTCCTGGGGATGG -3'
(R):5'- GAGCCTCACCATGAATTTAAGAC -3'

Sequencing Primer
(F):5'- AGGAGACTTTGCATTTATGTTAAGC -3'
(R):5'- TCACCATGAATTTAAGACCTCAAGG -3'
Posted On2015-07-07