Incidental Mutation 'R4425:Rims2'
ID328128
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R4425 (G1)
Quality Score184
Status Validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 39437924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243] [ENSMUST00000228839]
Predicted Effect probably null
Transcript: ENSMUST00000042917
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082054
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226243
Predicted Effect probably null
Transcript: ENSMUST00000227243
Predicted Effect probably null
Transcript: ENSMUST00000227381
Predicted Effect probably null
Transcript: ENSMUST00000228839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228867
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGTTCAGACCAGTCCGAGTC -3'
(R):5'- ATCTAAGGATGTAGAAACCCTCAG -3'

Sequencing Primer
(F):5'- ACCAGTCCGAGTCAGTGAG -3'
(R):5'- TCTACCATGGCCAACACT -3'
Posted On2015-07-07