Incidental Mutation 'R4425:Zfp811'
ID328134
Institutional Source Beutler Lab
Gene Symbol Zfp811
Ensembl Gene ENSMUSG00000055202
Gene Namezinc finger protein 811
Synonyms
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4425 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32795676-32809853 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 32797547 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 506 (C506*)
Ref Sequence ENSEMBL: ENSMUSP00000144038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080905] [ENSMUST00000200914]
Predicted Effect probably null
Transcript: ENSMUST00000080905
AA Change: C505*
SMART Domains Protein: ENSMUSP00000079709
Gene: ENSMUSG00000055202
AA Change: C505*

DomainStartEndE-ValueType
KRAB 3 62 6.26e-16 SMART
ZnF_C2H2 192 215 1.25e-1 SMART
ZnF_C2H2 220 242 1.79e-2 SMART
ZnF_C2H2 248 270 9.08e-4 SMART
ZnF_C2H2 276 298 7.78e-3 SMART
ZnF_C2H2 304 326 3.69e-4 SMART
ZnF_C2H2 332 354 8.47e-4 SMART
ZnF_C2H2 360 382 1.45e-2 SMART
ZnF_C2H2 388 410 6.42e-4 SMART
ZnF_C2H2 416 438 5.9e-3 SMART
ZnF_C2H2 444 466 1.08e-1 SMART
ZnF_C2H2 472 494 2.75e-3 SMART
ZnF_C2H2 500 522 9.44e-2 SMART
ZnF_C2H2 528 551 3.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104150
Predicted Effect probably null
Transcript: ENSMUST00000200914
AA Change: C506*
SMART Domains Protein: ENSMUSP00000144038
Gene: ENSMUSG00000055202
AA Change: C506*

DomainStartEndE-ValueType
KRAB 4 63 2.6e-18 SMART
ZnF_C2H2 193 216 5.4e-4 SMART
ZnF_C2H2 221 243 7.8e-5 SMART
ZnF_C2H2 249 271 3.8e-6 SMART
ZnF_C2H2 277 299 3.3e-5 SMART
ZnF_C2H2 305 327 1.6e-6 SMART
ZnF_C2H2 333 355 3.8e-6 SMART
ZnF_C2H2 361 383 6.1e-5 SMART
ZnF_C2H2 389 411 2.7e-6 SMART
ZnF_C2H2 417 439 2.5e-5 SMART
ZnF_C2H2 445 467 4.6e-4 SMART
ZnF_C2H2 473 495 1.2e-5 SMART
ZnF_C2H2 501 523 4e-4 SMART
ZnF_C2H2 529 552 1.7e-5 SMART
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Other mutations in Zfp811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp811 APN 17 32797820 missense probably damaging 1.00
IGL02227:Zfp811 APN 17 32798642 nonsense probably null
IGL02529:Zfp811 APN 17 32797815 missense probably damaging 1.00
IGL03190:Zfp811 APN 17 32798881 splice site probably benign
R0112:Zfp811 UTSW 17 32797764 missense probably damaging 0.96
R1025:Zfp811 UTSW 17 32798644 missense probably benign 0.00
R1522:Zfp811 UTSW 17 32797648 missense probably damaging 1.00
R1829:Zfp811 UTSW 17 32798142 missense possibly damaging 0.72
R1861:Zfp811 UTSW 17 32797425 missense probably damaging 1.00
R2181:Zfp811 UTSW 17 32797721 missense probably damaging 0.96
R4360:Zfp811 UTSW 17 32798458 missense probably benign 0.01
R4657:Zfp811 UTSW 17 32800923 nonsense probably null
R6066:Zfp811 UTSW 17 32798827 missense possibly damaging 0.73
R6109:Zfp811 UTSW 17 32797374 unclassified probably null
R6702:Zfp811 UTSW 17 32797842 missense probably damaging 1.00
R6714:Zfp811 UTSW 17 32797762 missense probably damaging 1.00
R6826:Zfp811 UTSW 17 32797788 missense probably damaging 1.00
R6983:Zfp811 UTSW 17 32797432 nonsense probably null
R7276:Zfp811 UTSW 17 32798781 missense probably benign 0.00
R7343:Zfp811 UTSW 17 32797513 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTATGGATTTATGCCACTGTG -3'
(R):5'- TGGCATCAAACCCTACATGTG -3'

Sequencing Primer
(F):5'- ATGCCACTGTGTATGGCTTTC -3'
(R):5'- CCTACATGTGCAAACAATGTGG -3'
Posted On2015-07-07