Incidental Mutation 'R4426:Chil5'
ID328149
Institutional Source Beutler Lab
Gene Symbol Chil5
Ensembl Gene ENSMUSG00000043873
Gene Namechitinase-like 5
SynonymsChi3l7, Bclp1, Bclp2
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location106016919-106032814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106019627 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 231 (S231P)
Ref Sequence ENSEMBL: ENSMUSP00000142477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010280] [ENSMUST00000066537] [ENSMUST00000200146]
Predicted Effect probably benign
Transcript: ENSMUST00000010280
SMART Domains Protein: ENSMUSP00000010280
Gene: ENSMUSG00000010136

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 183 209 5.2e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000054973
AA Change: I93T
SMART Domains Protein: ENSMUSP00000052345
Gene: ENSMUSG00000043873
AA Change: I93T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_18 1 156 5.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066537
SMART Domains Protein: ENSMUSP00000065043
Gene: ENSMUSG00000043873

DomainStartEndE-ValueType
Glyco_18 1 174 2.61e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198855
Predicted Effect probably damaging
Transcript: ENSMUST00000200146
AA Change: S231P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142477
Gene: ENSMUSG00000043873
AA Change: S231P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 2.1e-133 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Chil5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Chil5 APN 3 106017152 missense possibly damaging 0.73
IGL02959:Chil5 APN 3 106019590 missense probably damaging 1.00
R0255:Chil5 UTSW 3 106019267 missense probably damaging 1.00
R0409:Chil5 UTSW 3 106034966 unclassified probably benign
R0635:Chil5 UTSW 3 106017203 missense possibly damaging 0.50
R1403:Chil5 UTSW 3 106018093 missense probably benign 0.06
R1403:Chil5 UTSW 3 106018093 missense probably benign 0.06
R3500:Chil5 UTSW 3 106018220 missense probably damaging 1.00
R4680:Chil5 UTSW 3 106034875 unclassified probably benign
R4998:Chil5 UTSW 3 106019932 missense probably damaging 0.99
R5045:Chil5 UTSW 3 106024140 missense possibly damaging 0.61
R5113:Chil5 UTSW 3 106017978 missense possibly damaging 0.91
R5274:Chil5 UTSW 3 106028853 missense probably damaging 1.00
R5627:Chil5 UTSW 3 106019635 missense probably damaging 1.00
R6910:Chil5 UTSW 3 106019661 missense probably damaging 1.00
R7476:Chil5 UTSW 3 106020007 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGGCCTTAGTTAGATCTGTGC -3'
(R):5'- TGCATGAGCTTTGTTTACAGTC -3'

Sequencing Primer
(F):5'- ATCTGTGCTGGGTTATATTACTTGCC -3'
(R):5'- AGCTTTGTTTACAGTCTTTGAATGG -3'
Posted On2015-07-07