Incidental Mutation 'R4426:Atp8a1'
ID328155
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67774828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 206 (I206S)
Ref Sequence ENSEMBL: ENSMUSP00000144465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
AA Change: I206S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685
AA Change: I206S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
AA Change: I206S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685
AA Change: I206S

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130652
Predicted Effect probably benign
Transcript: ENSMUST00000135930
AA Change: I206S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685
AA Change: I206S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155911
Predicted Effect probably benign
Transcript: ENSMUST00000200955
AA Change: I206S

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685
AA Change: I206S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCAGTATCTAGAACAGGAGACAACC -3'
(R):5'- TGTGCTAAAAGTCTGTGCTCAC -3'

Sequencing Primer
(F):5'- CAACCTTGTGTCAGCAGATG -3'
(R):5'- CTAAAAGTCTGTGCTCACATGGAG -3'
Posted On2015-07-07