Incidental Mutation 'R4426:Zfp715'
ID328165
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43311092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000114600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
AA Change: D25G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640
AA Change: D25G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: D25G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: D25G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: D25G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: D25G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135130
AA Change: D25G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640
AA Change: D25G

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139061
AA Change: D25G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640
AA Change: D25G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000145622
AA Change: D25G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACTACTGGAGAGGTTGAGGC -3'
(R):5'- TAGGCCCTCACCAATTCATG -3'

Sequencing Primer
(F):5'- GCCTGGGCTATATGAAAGAATTCC -3'
(R):5'- CCAATTCATGGTCAGATGTTTGG -3'
Posted On2015-07-07