Incidental Mutation 'R4426:Olfr600'
ID328169
Institutional Source Beutler Lab
Gene Symbol Olfr600
Ensembl Gene ENSMUSG00000045540
Gene Nameolfactory receptor 600
SynonymsGA_x6K02T2PBJ9-6056235-6055291, MOR39-1
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103343482-103349669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103346083 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 282 (Y282H)
Ref Sequence ENSEMBL: ENSMUSP00000148967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056222] [ENSMUST00000215042]
Predicted Effect probably damaging
Transcript: ENSMUST00000056222
AA Change: Y282H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053887
Gene: ENSMUSG00000045540
AA Change: Y282H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.1e-97 PFAM
Pfam:7TM_GPCR_Srsx 37 226 1.2e-12 PFAM
Pfam:7tm_1 43 305 7.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215042
AA Change: Y282H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Olfr600
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr600 APN 7 103346179 missense probably benign 0.15
IGL02239:Olfr600 APN 7 103346598 missense probably damaging 1.00
IGL02285:Olfr600 APN 7 103346038 nonsense probably null
IGL02547:Olfr600 APN 7 103346244 missense probably damaging 1.00
IGL03149:Olfr600 APN 7 103346849 missense probably benign 0.00
R0193:Olfr600 UTSW 7 103346204 missense possibly damaging 0.74
R0304:Olfr600 UTSW 7 103346711 missense probably damaging 1.00
R0454:Olfr600 UTSW 7 103346878 missense probably benign 0.02
R0622:Olfr600 UTSW 7 103346857 missense probably damaging 0.97
R1988:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R1989:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R2937:Olfr600 UTSW 7 103346065 missense probably benign 0.18
R5362:Olfr600 UTSW 7 103346247 missense probably damaging 1.00
R5723:Olfr600 UTSW 7 103346619 missense possibly damaging 0.85
R6793:Olfr600 UTSW 7 103346266 missense probably benign 0.00
R6863:Olfr600 UTSW 7 103346916 missense possibly damaging 0.86
R6935:Olfr600 UTSW 7 103346795 missense probably damaging 1.00
R6983:Olfr600 UTSW 7 103346815 missense probably benign 0.00
R7262:Olfr600 UTSW 7 103346557 missense probably damaging 1.00
R7313:Olfr600 UTSW 7 103346331 missense probably benign 0.06
X0018:Olfr600 UTSW 7 103346899 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTTTCAAGAAAATCCTGAACTG -3'
(R):5'- GGTCATCCTGTCGTATACACTG -3'

Sequencing Primer
(F):5'- TGGTAGAAATTATATGAACTTCTGGC -3'
(R):5'- GTATACACTGATTCTTCGTGCTG -3'
Posted On2015-07-07