Incidental Mutation 'R4426:Ppp1r9b'
ID328191
Institutional Source Beutler Lab
Gene Symbol Ppp1r9b
Ensembl Gene ENSMUSG00000038976
Gene Nameprotein phosphatase 1, regulatory subunit 9B
SynonymsSPL, Spn, spinophilin, neurabin II
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94991035-95006899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95001324 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 188 (R188S)
Ref Sequence ENSEMBL: ENSMUSP00000103377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038696] [ENSMUST00000107748]
Predicted Effect probably benign
Transcript: ENSMUST00000038696
AA Change: R612S

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041732
Gene: ENSMUSG00000038976
AA Change: R612S

DomainStartEndE-ValueType
low complexity region 64 83 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 253 260 N/A INTRINSIC
low complexity region 281 317 N/A INTRINSIC
low complexity region 332 361 N/A INTRINSIC
low complexity region 399 430 N/A INTRINSIC
Blast:PDZ 431 458 4e-10 BLAST
PDZ 504 584 7.03e-19 SMART
low complexity region 600 612 N/A INTRINSIC
Blast:PDZ 731 768 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107748
AA Change: R188S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103377
Gene: ENSMUSG00000038976
AA Change: R188S

DomainStartEndE-ValueType
PDZ 80 160 7.03e-19 SMART
low complexity region 176 188 N/A INTRINSIC
Blast:PDZ 307 344 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151771
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal glutamatergic synaptic transmission, reduced long-term depression, resistance to kainate-induced seizures, impaired taste aversion learning, and increased dendritic spine density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Ppp1r9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Ppp1r9b APN 11 95005354 missense probably damaging 0.96
IGL02261:Ppp1r9b APN 11 95002110 missense probably damaging 1.00
R0068:Ppp1r9b UTSW 11 95001220 missense probably damaging 1.00
R0719:Ppp1r9b UTSW 11 95001835 splice site probably null
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1385:Ppp1r9b UTSW 11 94992211 missense probably benign 0.06
R1639:Ppp1r9b UTSW 11 94996610 missense probably damaging 1.00
R1642:Ppp1r9b UTSW 11 95001324 synonymous silent
R2000:Ppp1r9b UTSW 11 94996620 missense probably damaging 1.00
R2162:Ppp1r9b UTSW 11 94998051 missense probably damaging 1.00
R2332:Ppp1r9b UTSW 11 94996609 missense probably damaging 0.96
R3815:Ppp1r9b UTSW 11 94992533 missense probably damaging 1.00
R4427:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R5121:Ppp1r9b UTSW 11 94996653 missense probably damaging 0.99
R5205:Ppp1r9b UTSW 11 95001298 missense probably benign 0.11
R5348:Ppp1r9b UTSW 11 94996612 nonsense probably null
R5397:Ppp1r9b UTSW 11 95002110 missense probably damaging 1.00
R5399:Ppp1r9b UTSW 11 94992148 missense probably benign
R6188:Ppp1r9b UTSW 11 94991836 missense probably damaging 0.99
R6860:Ppp1r9b UTSW 11 94992148 missense probably benign
R7308:Ppp1r9b UTSW 11 95004571 missense possibly damaging 0.86
R7357:Ppp1r9b UTSW 11 95004598 missense probably benign 0.00
R7479:Ppp1r9b UTSW 11 94992032 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGTGGCATTCCCAGCTGTAG -3'
(R):5'- AGTGGGACTCTCCTGTTTGAC -3'

Sequencing Primer
(F):5'- ATTCCCAGCTGTAGCCAGG -3'
(R):5'- TGACCCGGAGTTCTCTGAG -3'
Posted On2015-07-07