Incidental Mutation 'R4426:Robo2'
ID328201
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 041697-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73948266 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 200 (M200L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000116586
AA Change: M878L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: M878L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117200
AA Change: M874L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: M874L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117785
AA Change: M874L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: M874L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226478
AA Change: M878L

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227347
AA Change: M878L

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000231889
AA Change: M200L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGAGCAATGCACTGAGGC -3'
(R):5'- CGTCTGTGCCTTTGGTATAACG -3'

Sequencing Primer
(F):5'- CAATGCACTGAGGCATGCTG -3'
(R):5'- CCTTTGGTATAACGTGTTTGTATTCC -3'
Posted On2015-07-07