Incidental Mutation 'R4426:Nrip1'
ID328202
Institutional Source Beutler Lab
Gene Symbol Nrip1
Ensembl Gene ENSMUSG00000048490
Gene Namenuclear receptor interacting protein 1
SynonymsRIP140, 6030458L20Rik, 8430438I05Rik
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location76287400-76373827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76291405 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1088 (Q1088R)
Ref Sequence ENSEMBL: ENSMUSP00000112959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054178] [ENSMUST00000121927] [ENSMUST00000140483] [ENSMUST00000231585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054178
AA Change: Q1088R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051726
Gene: ENSMUSG00000048490
AA Change: Q1088R

DomainStartEndE-ValueType
low complexity region 182 195 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
PDB:2GPP|D 368 392 2e-7 PDB
low complexity region 707 718 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121927
AA Change: Q1088R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112959
Gene: ENSMUSG00000048490
AA Change: Q1088R

DomainStartEndE-ValueType
Pfam:NRIP1_repr_1 27 331 5.4e-141 PFAM
PDB:2GPP|D 368 392 2e-7 PDB
Pfam:NRIP1_repr_2 412 739 7.5e-122 PFAM
Pfam:NRIP1_repr_3 754 841 8.4e-45 PFAM
Pfam:NRIP1_repr_4 849 1161 1.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231304
Predicted Effect probably benign
Transcript: ENSMUST00000231585
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for targeted disruption of this gene results in female infertility due to ovulation failure. Heterozygous females are partially affected. Male and female mice are smaller than wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Nrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nrip1 APN 16 76293703 missense possibly damaging 0.48
IGL00732:Nrip1 APN 16 76293061 missense probably benign 0.31
IGL02024:Nrip1 APN 16 76291675 missense probably benign 0.05
IGL02172:Nrip1 APN 16 76291492 missense probably damaging 0.99
IGL02432:Nrip1 APN 16 76291780 missense probably benign 0.04
IGL03025:Nrip1 APN 16 76294465 missense probably benign 0.06
IGL03410:Nrip1 APN 16 76292491 missense probably benign
PIT4802001:Nrip1 UTSW 16 76293269 missense probably damaging 0.97
R0064:Nrip1 UTSW 16 76294670 utr 5 prime probably benign
R0304:Nrip1 UTSW 16 76292707 missense possibly damaging 0.67
R0320:Nrip1 UTSW 16 76292363 missense probably benign 0.00
R0368:Nrip1 UTSW 16 76294016 missense probably damaging 0.99
R1730:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1783:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1850:Nrip1 UTSW 16 76293344 missense probably damaging 1.00
R1900:Nrip1 UTSW 16 76292039 missense probably benign
R2252:Nrip1 UTSW 16 76291285 missense probably damaging 1.00
R3935:Nrip1 UTSW 16 76294435 missense possibly damaging 0.67
R4290:Nrip1 UTSW 16 76291988 missense probably benign 0.00
R4598:Nrip1 UTSW 16 76293080 missense probably damaging 1.00
R4607:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R4608:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R5893:Nrip1 UTSW 16 76293953 missense probably damaging 1.00
R5939:Nrip1 UTSW 16 76292122 missense probably damaging 0.99
R5966:Nrip1 UTSW 16 76293583 missense possibly damaging 0.47
R6093:Nrip1 UTSW 16 76294764 start gained probably benign
R6154:Nrip1 UTSW 16 76293830 missense probably damaging 1.00
R6639:Nrip1 UTSW 16 76293995 nonsense probably null
R6910:Nrip1 UTSW 16 76294417 missense probably damaging 1.00
R6921:Nrip1 UTSW 16 76292588 missense possibly damaging 0.88
R7314:Nrip1 UTSW 16 76291190 missense probably benign 0.00
R7346:Nrip1 UTSW 16 76293356 missense possibly damaging 0.81
R7386:Nrip1 UTSW 16 76293887 missense probably damaging 1.00
R7485:Nrip1 UTSW 16 76291450 missense probably damaging 1.00
R7506:Nrip1 UTSW 16 76294459 missense probably damaging 1.00
R7517:Nrip1 UTSW 16 76291184 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGCAGGTACACATTTATTCTGACTC -3'
(R):5'- TTGAATGGATGTTCCGTGCC -3'

Sequencing Primer
(F):5'- GCGTTTCCCAGAAGTCCATAC -3'
(R):5'- CCGGTGAGAAGGGACCCATTAAG -3'
Posted On2015-07-07