Incidental Mutation 'R4426:Vmn2r106'
ID328203
Institutional Source Beutler Lab
Gene Symbol Vmn2r106
Ensembl Gene ENSMUSG00000091656
Gene Namevomeronasal 2, receptor 106
SynonymsEG224576
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20267547-20285430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20285379 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000126534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167464]
Predicted Effect probably benign
Transcript: ENSMUST00000167464
AA Change: S18P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656
AA Change: S18P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 471 3.8e-37 PFAM
Pfam:NCD3G 514 567 5.7e-22 PFAM
Pfam:7tm_3 596 835 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Vmn2r106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Vmn2r106 APN 17 20277575 missense possibly damaging 0.90
IGL01313:Vmn2r106 APN 17 20278389 missense probably damaging 0.99
IGL01419:Vmn2r106 APN 17 20279545 missense probably benign 0.06
IGL01574:Vmn2r106 APN 17 20268310 missense possibly damaging 0.94
IGL01796:Vmn2r106 APN 17 20268052 missense possibly damaging 0.79
IGL01893:Vmn2r106 APN 17 20277468 missense probably benign 0.06
IGL01895:Vmn2r106 APN 17 20278965 missense probably benign 0.02
IGL02378:Vmn2r106 APN 17 20277529 missense probably damaging 1.00
IGL02430:Vmn2r106 APN 17 20278896 missense probably benign 0.38
IGL02664:Vmn2r106 APN 17 20268082 missense possibly damaging 0.88
IGL03308:Vmn2r106 APN 17 20278523 nonsense probably null
IGL03384:Vmn2r106 APN 17 20268143 missense probably damaging 0.99
R0401:Vmn2r106 UTSW 17 20279019 missense possibly damaging 0.86
R0842:Vmn2r106 UTSW 17 20268203 missense probably damaging 1.00
R0964:Vmn2r106 UTSW 17 20267597 missense probably benign 0.00
R1235:Vmn2r106 UTSW 17 20279479 missense probably benign 0.00
R1709:Vmn2r106 UTSW 17 20279111 missense probably benign 0.12
R1712:Vmn2r106 UTSW 17 20278735 missense probably benign 0.01
R1770:Vmn2r106 UTSW 17 20268298 missense probably damaging 0.99
R2049:Vmn2r106 UTSW 17 20268304 missense possibly damaging 0.90
R2245:Vmn2r106 UTSW 17 20268161 missense probably benign 0.13
R2336:Vmn2r106 UTSW 17 20268208 missense probably benign 0.18
R2910:Vmn2r106 UTSW 17 20278684 missense probably damaging 1.00
R3025:Vmn2r106 UTSW 17 20278885 missense probably benign 0.00
R3944:Vmn2r106 UTSW 17 20267651 missense probably damaging 1.00
R4081:Vmn2r106 UTSW 17 20267556 nonsense probably null
R4153:Vmn2r106 UTSW 17 20267818 missense probably damaging 1.00
R4356:Vmn2r106 UTSW 17 20279648 missense probably benign 0.06
R4590:Vmn2r106 UTSW 17 20277466 missense probably damaging 0.99
R4661:Vmn2r106 UTSW 17 20267623 missense probably benign 0.10
R5106:Vmn2r106 UTSW 17 20279133 critical splice acceptor site probably null
R5341:Vmn2r106 UTSW 17 20277526 missense probably benign 0.00
R5509:Vmn2r106 UTSW 17 20278422 missense probably damaging 0.99
R5826:Vmn2r106 UTSW 17 20278871 missense probably benign
R5859:Vmn2r106 UTSW 17 20285321 missense possibly damaging 0.72
R5937:Vmn2r106 UTSW 17 20285405 nonsense probably null
R5972:Vmn2r106 UTSW 17 20278476 missense probably benign
R6056:Vmn2r106 UTSW 17 20267544 unclassified probably null
R6108:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6114:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6115:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6132:Vmn2r106 UTSW 17 20268404 missense probably benign
R6208:Vmn2r106 UTSW 17 20268329 missense probably damaging 0.99
R6217:Vmn2r106 UTSW 17 20268239 missense probably benign 0.10
R6289:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6378:Vmn2r106 UTSW 17 20278405 missense probably benign 0.19
R6390:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6391:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6392:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6405:Vmn2r106 UTSW 17 20279099 missense probably benign 0.22
R6427:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6428:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6435:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6436:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6437:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6511:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6512:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6587:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6703:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6730:Vmn2r106 UTSW 17 20278834 missense possibly damaging 0.64
R6961:Vmn2r106 UTSW 17 20268384 nonsense probably null
R7054:Vmn2r106 UTSW 17 20278920 missense probably damaging 0.96
R7379:Vmn2r106 UTSW 17 20267775 missense possibly damaging 0.75
R7402:Vmn2r106 UTSW 17 20267621 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTATTCCACCTGAGAGAGGAAAAG -3'
(R):5'- AAAATTCCCAATGCCAGGGG -3'

Sequencing Primer
(F):5'- CCACCTGAGAGAGGAAAAGAAGCC -3'
(R):5'- AAGCCTGGGAATAATTAGTGTGTC -3'
Posted On2015-07-07