Incidental Mutation 'R4426:Stx5a'
ID328209
Institutional Source Beutler Lab
Gene Symbol Stx5a
Ensembl Gene ENSMUSG00000010110
Gene Namesyntaxin 5A
SynonymsD19Ertd627e, 0610031F24Rik, syntaxin 5
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8741413-8756069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8749740 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000010254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010254] [ENSMUST00000073430] [ENSMUST00000175872] [ENSMUST00000175901] [ENSMUST00000176013] [ENSMUST00000176381] [ENSMUST00000176570] [ENSMUST00000176968] [ENSMUST00000177322] [ENSMUST00000177373]
Predicted Effect probably benign
Transcript: ENSMUST00000010254
AA Change: T252A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000010254
Gene: ENSMUSG00000010110
AA Change: T252A

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin-5_N 52 74 1.5e-15 PFAM
SCOP:d1fioa_ 92 298 7e-36 SMART
Blast:t_SNARE 258 304 9e-22 BLAST
low complexity region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073430
AA Change: T252A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073136
Gene: ENSMUSG00000010110
AA Change: T252A

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175834
Predicted Effect probably benign
Transcript: ENSMUST00000175872
SMART Domains Protein: ENSMUSP00000135416
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175901
AA Change: T252A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134951
Gene: ENSMUSG00000010110
AA Change: T252A

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176009
Predicted Effect probably benign
Transcript: ENSMUST00000176013
SMART Domains Protein: ENSMUSP00000135465
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 143 3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176260
Predicted Effect probably benign
Transcript: ENSMUST00000176381
AA Change: T252A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134854
Gene: ENSMUSG00000010110
AA Change: T252A

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176404
Predicted Effect probably benign
Transcript: ENSMUST00000176570
AA Change: T6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134892
Gene: ENSMUSG00000010110
AA Change: T6A

DomainStartEndE-ValueType
Pfam:SNARE 22 57 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176844
Predicted Effect probably benign
Transcript: ENSMUST00000176968
AA Change: T6A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135468
Gene: ENSMUSG00000010110
AA Change: T6A

DomainStartEndE-ValueType
t_SNARE 12 79 4.33e-15 SMART
transmembrane domain 88 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177322
SMART Domains Protein: ENSMUSP00000135624
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177373
AA Change: T156A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134794
Gene: ENSMUSG00000010110
AA Change: T156A

DomainStartEndE-ValueType
Pfam:Syntaxin 1 98 5.2e-15 PFAM
t_SNARE 162 229 4.33e-15 SMART
transmembrane domain 238 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Stx5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03152:Stx5a APN 19 8749774 critical splice donor site probably null
R0541:Stx5a UTSW 19 8749937 missense probably damaging 1.00
R0726:Stx5a UTSW 19 8754911 missense probably damaging 1.00
R1566:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R1990:Stx5a UTSW 19 8748890 critical splice donor site probably null
R2852:Stx5a UTSW 19 8755112 unclassified probably benign
R3022:Stx5a UTSW 19 8755154 unclassified probably benign
R4684:Stx5a UTSW 19 8743361 missense probably damaging 0.96
R5594:Stx5a UTSW 19 8748465 missense probably damaging 1.00
R5750:Stx5a UTSW 19 8755137 unclassified probably benign
R5929:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R6644:Stx5a UTSW 19 8755248 unclassified probably benign
R6983:Stx5a UTSW 19 8755169 unclassified probably benign
R7242:Stx5a UTSW 19 8755277 missense unknown
R7258:Stx5a UTSW 19 8754907 critical splice acceptor site probably null
X0020:Stx5a UTSW 19 8748890 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GAACCATGCCTATACATTCTCATG -3'
(R):5'- TGGATGTAGGAATCCTTCAGAAG -3'

Sequencing Primer
(F):5'- GATCAGATTGGCCTCAGACTCATAG -3'
(R):5'- GAAGAAAACACCATGAACTAGGGCC -3'
Posted On2015-07-07