Incidental Mutation 'R4427:BC055324'
ID328216
Institutional Source Beutler Lab
Gene Symbol BC055324
Ensembl Gene ENSMUSG00000041406
Gene NamecDNA sequence BC055324
Synonyms
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163945993-163994796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163954284 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 858 (V858A)
Ref Sequence ENSEMBL: ENSMUSP00000095101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027876] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000159516] [ENSMUST00000159617] [ENSMUST00000161908] [ENSMUST00000162234] [ENSMUST00000170359]
Predicted Effect probably benign
Transcript: ENSMUST00000027876
SMART Domains Protein: ENSMUSP00000027876
Gene: ENSMUSG00000026584

DomainStartEndE-ValueType
Pfam:Pkinase 32 245 1.9e-7 PFAM
low complexity region 525 541 N/A INTRINSIC
low complexity region 711 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
AA Change: V858A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406
AA Change: V858A

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
AA Change: V858A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406
AA Change: V858A

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159516
Predicted Effect probably benign
Transcript: ENSMUST00000159617
Predicted Effect probably benign
Transcript: ENSMUST00000161908
SMART Domains Protein: ENSMUSP00000125735
Gene: ENSMUSG00000026584

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162920
Predicted Effect probably benign
Transcript: ENSMUST00000170359
SMART Domains Protein: ENSMUSP00000132109
Gene: ENSMUSG00000026584

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in BC055324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:BC055324 APN 1 163957522 missense probably benign 0.01
IGL02638:BC055324 APN 1 163959299 nonsense probably null
IGL03337:BC055324 APN 1 163990759 missense probably damaging 0.96
IGL03048:BC055324 UTSW 1 163964525 missense probably benign 0.04
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0414:BC055324 UTSW 1 163968321 missense probably benign 0.02
R0511:BC055324 UTSW 1 163971843 splice site probably null
R1323:BC055324 UTSW 1 163955461 unclassified probably benign
R1870:BC055324 UTSW 1 163964794 missense probably damaging 1.00
R2129:BC055324 UTSW 1 163966457 missense probably damaging 1.00
R3716:BC055324 UTSW 1 163956888 missense probably damaging 1.00
R3783:BC055324 UTSW 1 163987683 missense probably benign 0.27
R3872:BC055324 UTSW 1 163986964 missense probably damaging 0.99
R5069:BC055324 UTSW 1 163987674 missense possibly damaging 0.59
R5620:BC055324 UTSW 1 163962044 nonsense probably null
R5681:BC055324 UTSW 1 163962085 missense probably damaging 1.00
R5699:BC055324 UTSW 1 163957551 missense probably benign 0.26
R5936:BC055324 UTSW 1 163987012 missense probably benign 0.00
R6065:BC055324 UTSW 1 163959388 missense probably benign 0.08
R6065:BC055324 UTSW 1 163987688 missense probably damaging 1.00
R6075:BC055324 UTSW 1 163978087 missense probably damaging 1.00
R6466:BC055324 UTSW 1 163954165 missense probably benign 0.01
R6701:BC055324 UTSW 1 163971843 splice site probably null
R6776:BC055324 UTSW 1 163976749 missense probably damaging 1.00
R6851:BC055324 UTSW 1 163964767 missense probably damaging 1.00
R6923:BC055324 UTSW 1 163986885 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTTCTGTCGATACACAGG -3'
(R):5'- ACTTCTTGTCTGCCACATACAAG -3'

Sequencing Primer
(F):5'- TGTCGATACACAGGCCATTC -3'
(R):5'- TGTCTGCCACATACAAGTTAGGACG -3'
Posted On2015-07-07