Incidental Mutation 'R4427:Zfp982'
ID328222
Institutional Source Beutler Lab
Gene Symbol Zfp982
Ensembl Gene ENSMUSG00000078496
Gene Namezinc finger protein 982
SynonymsGm13152
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4427 (G1)
Quality Score120
Status Validated
Chromosome4
Chromosomal Location147492417-147513486 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 147512623 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 146 (R146*)
Ref Sequence ENSEMBL: ENSMUSP00000101346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063704] [ENSMUST00000105721]
Predicted Effect probably null
Transcript: ENSMUST00000063704
AA Change: R146*
SMART Domains Protein: ENSMUSP00000068021
Gene: ENSMUSG00000078496
AA Change: R146*

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105721
AA Change: R146*
SMART Domains Protein: ENSMUSP00000101346
Gene: ENSMUSG00000078496
AA Change: R146*

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Meta Mutation Damage Score 0.6324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Other mutations in Zfp982
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Zfp982 APN 4 147512369 missense probably benign
IGL02989:Zfp982 APN 4 147512595 missense possibly damaging 0.47
R0035:Zfp982 UTSW 4 147512692 missense probably benign 0.00
R0123:Zfp982 UTSW 4 147512636 missense probably benign 0.04
R1502:Zfp982 UTSW 4 147512669 missense probably benign 0.00
R1982:Zfp982 UTSW 4 147512592 nonsense probably null
R4181:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4182:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4183:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4184:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4814:Zfp982 UTSW 4 147512633 missense possibly damaging 0.58
R5697:Zfp982 UTSW 4 147512589 missense probably benign 0.02
R5777:Zfp982 UTSW 4 147510864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTACATTGTCCATGAACAC -3'
(R):5'- GATGCCTTCTCAGTTTGCG -3'

Sequencing Primer
(F):5'- AGAAGTCTTCTAAATGGAACAAGC -3'
(R):5'- CTCAGTTTGCGTTTTTCAGTAAAGC -3'
Posted On2015-07-07