Mutagenetix > Incidental Mutations

Incidental Mutation 'R4427:Vmn2r73'

328229

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r73

Ensembl Gene

ENSMUSG00000070458

Gene Name

vomeronasal 2, receptor 73

Synonyms

EG620928

MMRRC Submission

041145-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.229) question?

Stock #

R4427 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85857547-85875938 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85857773 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 777 (F777S)

Ref Sequence

ENSEMBL: ENSMUSP00000076687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077478]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077478
AA Change: F777S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: F777S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	465	1.4e-30	PFAM
Pfam:NCD3G	508	560	5.9e-21	PFAM
Pfam:7tm_3	590	827	4.4e-51	PFAM

Meta Mutation Damage Score

0.1068

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

96% (48/50)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,579,253		noncoding transcript	Het
A2ml1	T	C	6: 128,545,046	E1271G	probably benign	Het
BC053393	T	A	11: 46,584,420	F147L	probably benign	Het
BC055324	A	G	1: 163,954,284	V858A	probably benign	Het
Ccdc189	A	G	7: 127,588,116		probably benign	Het
Ccdc88b	C	T	19: 6,850,572	E878K	probably damaging	Het
Crybg3	T	C	16: 59,543,199	K2441E	probably damaging	Het
Cryga	A	T	1: 65,100,616	I121N	probably damaging	Het
Dst	A	T	1: 34,181,460	Q2115L	probably benign	Het
Evi2	T	A	11: 79,516,356	Q131L	possibly damaging	Het
Exoc1	A	G	5: 76,563,263	I61V	probably benign	Het
Frem2	A	G	3: 53,539,162		probably null	Het
Gas2l1	A	G	11: 5,063,908	V184A	probably benign	Het
Gsto2	T	C	19: 47,871,773	S2P	possibly damaging	Het
Herc1	T	C	9: 66,496,005	L4402P	probably damaging	Het
Kcnd2	T	A	6: 21,216,897	I200N	probably damaging	Het
Klhl30	A	G	1: 91,353,704	D9G	probably damaging	Het
Ltf	C	A	9: 111,023,604	T178K	probably damaging	Het
Memo1	T	A	17: 74,202,307	Y239F	probably benign	Het
Ogdh	C	T	11: 6,355,421	T972I	probably benign	Het
Phactr4	T	C	4: 132,387,041	D24G	possibly damaging	Het
Pi4ka	C	T	16: 17,281,044	R1992H	probably damaging	Het
Poc1b	T	C	10: 99,155,139		probably null	Het
Ppp1r9b	A	T	11: 95,001,324	R188S	possibly damaging	Het
Pwwp2a	T	C	11: 43,682,517	V142A	possibly damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rcsd1	C	A	1: 165,655,895	V206L	probably damaging	Het
Rps6ka2	T	A	17: 7,299,405	D687E	possibly damaging	Het
Sgce	G	A	6: 4,691,459	A295V	probably damaging	Het
Siglec15	T	G	18: 78,043,621	E341A	possibly damaging	Het
Tcaim	T	C	9: 122,814,496	F87S	probably benign	Het
Thbs2	C	A	17: 14,680,335	V537L	probably benign	Het
Tmx3	T	A	18: 90,523,601	V158D	probably damaging	Het
Tpm1	A	G	9: 67,032,565		probably benign	Het
Trmt2a	A	G	16: 18,249,229		probably benign	Het
Ugcg	T	A	4: 59,219,555	F297L	probably benign	Het
Utp18	T	C	11: 93,866,438	N467D	probably damaging	Het
Vwc2	A	G	11: 11,154,235	T256A	probably damaging	Het
Zfp300	C	T	X: 21,083,166	V120I	possibly damaging	Het
Zfp982	A	T	4: 147,512,623	R146*	probably null	Het

Other mutations in Vmn2r73

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Vmn2r73	APN	7	85857587	missense	probably benign
IGL01151:Vmn2r73	APN	7	85857878	missense	probably damaging	0.99
IGL01408:Vmn2r73	APN	7	85872247	missense	probably benign	0.45
IGL01505:Vmn2r73	APN	7	85858059	nonsense	probably null
IGL01731:Vmn2r73	APN	7	85857549	makesense	probably null
IGL01818:Vmn2r73	APN	7	85869901	splice site	probably benign
IGL02236:Vmn2r73	APN	7	85872694	missense	probably benign	0.00
IGL02265:Vmn2r73	APN	7	85871639	missense	probably benign	0.02
IGL02266:Vmn2r73	APN	7	85875799	missense	possibly damaging	0.52
IGL02276:Vmn2r73	APN	7	85869772	critical splice donor site	probably null
IGL02284:Vmn2r73	APN	7	85857915	missense	possibly damaging	0.92
IGL02380:Vmn2r73	APN	7	85858175	missense	probably benign	0.00
IGL02466:Vmn2r73	APN	7	85872876	missense	probably damaging	1.00
IGL03172:Vmn2r73	APN	7	85858287	missense	probably benign	0.01
IGL03179:Vmn2r73	APN	7	85870260	missense	probably benign	0.04
R0077:Vmn2r73	UTSW	7	85875867	missense	probably benign	0.00
R0311:Vmn2r73	UTSW	7	85871789	missense	probably benign
R0413:Vmn2r73	UTSW	7	85871879	missense	possibly damaging	0.68
R0494:Vmn2r73	UTSW	7	85872932	missense	probably benign
R1523:Vmn2r73	UTSW	7	85870278	missense	probably benign	0.02
R1618:Vmn2r73	UTSW	7	85875912	nonsense	probably null
R1667:Vmn2r73	UTSW	7	85857681	missense	probably benign	0.00
R1728:Vmn2r73	UTSW	7	85857878	missense	probably damaging	1.00
R1729:Vmn2r73	UTSW	7	85857878	missense	probably damaging	1.00
R1747:Vmn2r73	UTSW	7	85858167	missense	probably damaging	1.00
R1784:Vmn2r73	UTSW	7	85857878	missense	probably damaging	1.00
R2152:Vmn2r73	UTSW	7	85857728	missense	probably benign	0.03
R2395:Vmn2r73	UTSW	7	85857767	missense	probably damaging	1.00
R2415:Vmn2r73	UTSW	7	85872223	missense	probably damaging	1.00
R2926:Vmn2r73	UTSW	7	85871663	missense	probably benign	0.17
R3719:Vmn2r73	UTSW	7	85870374	missense	probably damaging	1.00
R3766:Vmn2r73	UTSW	7	85871990	missense	probably benign
R3838:Vmn2r73	UTSW	7	85858050	missense	probably benign	0.00
R3890:Vmn2r73	UTSW	7	85857936	missense	probably benign
R4030:Vmn2r73	UTSW	7	85871836	missense	possibly damaging	0.92
R4247:Vmn2r73	UTSW	7	85872675	missense	probably damaging	0.99
R4409:Vmn2r73	UTSW	7	85871560	missense	probably damaging	0.97
R4430:Vmn2r73	UTSW	7	85870241	missense	probably benign
R4552:Vmn2r73	UTSW	7	85875847	missense	probably benign	0.12
R4779:Vmn2r73	UTSW	7	85871715	nonsense	probably null
R4906:Vmn2r73	UTSW	7	85857621	missense	probably damaging	0.99
R4942:Vmn2r73	UTSW	7	85870374	missense	probably damaging	1.00
R5280:Vmn2r73	UTSW	7	85857947	missense	probably damaging	0.98
R5344:Vmn2r73	UTSW	7	85875838	missense	probably benign	0.00
R5478:Vmn2r73	UTSW	7	85869788	missense	probably damaging	1.00
R5527:Vmn2r73	UTSW	7	85858367	missense	possibly damaging	0.65
R5691:Vmn2r73	UTSW	7	85858091	missense	probably damaging	1.00
R5826:Vmn2r73	UTSW	7	85875748	missense	possibly damaging	0.77
R6018:Vmn2r73	UTSW	7	85872667	missense	possibly damaging	0.48
R6082:Vmn2r73	UTSW	7	85858221	missense	probably benign	0.00
R6111:Vmn2r73	UTSW	7	85871789	missense	probably benign
R6233:Vmn2r73	UTSW	7	85869891	missense	probably benign	0.00
R6278:Vmn2r73	UTSW	7	85872932	missense	probably benign
R6283:Vmn2r73	UTSW	7	85871841	missense	probably benign	0.00
R6307:Vmn2r73	UTSW	7	85857620	missense	probably damaging	1.00
R6413:Vmn2r73	UTSW	7	85870336	nonsense	probably null
R6782:Vmn2r73	UTSW	7	85870355	missense	probably benign	0.00
R6884:Vmn2r73	UTSW	7	85858005	missense	probably benign	0.05
R6921:Vmn2r73	UTSW	7	85858238	missense	probably benign	0.27
X0023:Vmn2r73	UTSW	7	85858456	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TGATGAGTTGAAAGCAGCTTTG -3'
(R):5'- TGATGCTGATCTACACATGGTAC -3'

Sequencing Primer
(F):5'- CATATGAGAAGAATTTTTCCCTGGTC -3'
(R):5'- GGTACATGGCCACATCATCATTG -3'

Posted On

2015-07-07