Incidental Mutation 'R4427:Vmn2r73'
ID328229
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85857773 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 777 (F777S)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably damaging
Transcript: ENSMUST00000077478
AA Change: F777S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: F777S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGATGAGTTGAAAGCAGCTTTG -3'
(R):5'- TGATGCTGATCTACACATGGTAC -3'

Sequencing Primer
(F):5'- CATATGAGAAGAATTTTTCCCTGGTC -3'
(R):5'- GGTACATGGCCACATCATCATTG -3'
Posted On2015-07-07