Incidental Mutation 'R4427:Ltf'
ID328233
Institutional Source Beutler Lab
Gene Symbol Ltf
Ensembl Gene ENSMUSG00000032496
Gene Namelactotransferrin
SynonymsLf, lactoferrin
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111019271-111042767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111023604 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 178 (T178K)
Ref Sequence ENSEMBL: ENSMUSP00000143234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035077] [ENSMUST00000196122] [ENSMUST00000196209] [ENSMUST00000196777] [ENSMUST00000198884]
Predicted Effect probably damaging
Transcript: ENSMUST00000035077
AA Change: T231K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035077
Gene: ENSMUSG00000032496
AA Change: T231K

DomainStartEndE-ValueType
TR_FER 24 362 1.48e-209 SMART
TR_FER 363 696 4.68e-212 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196122
AA Change: T178K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143234
Gene: ENSMUSG00000032496
AA Change: T178K

DomainStartEndE-ValueType
TR_FER 4 183 6.4e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196209
SMART Domains Protein: ENSMUSP00000143731
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
Pfam:Transferrin 13 78 3.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196777
SMART Domains Protein: ENSMUSP00000143629
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 121 2.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197893
Predicted Effect probably benign
Transcript: ENSMUST00000198152
Predicted Effect probably benign
Transcript: ENSMUST00000198884
SMART Domains Protein: ENSMUSP00000142432
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 95 4.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200459
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and grossly normal and exhibit only minor alterations in iron homeostasis. Mice homozygous for a different knock-out allele show increased susceptibility to inflammation-induced colorectal dysplasia along with increased cell proliferation and decreased apoptosis in colonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Ltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ltf APN 9 111022882 intron probably null
IGL01068:Ltf APN 9 111035812 unclassified probably null
IGL01311:Ltf APN 9 111031012 unclassified probably benign
IGL01629:Ltf APN 9 111035806 missense probably damaging 1.00
IGL01765:Ltf APN 9 111022017 missense possibly damaging 0.86
IGL02376:Ltf APN 9 111029624 missense probably benign 0.01
IGL02429:Ltf APN 9 111026125 missense possibly damaging 0.87
IGL02947:Ltf APN 9 111038947 missense probably benign 0.01
IGL03025:Ltf APN 9 111025101 missense possibly damaging 0.93
R0041:Ltf UTSW 9 111029568 missense possibly damaging 0.92
R0364:Ltf UTSW 9 111025167 missense probably benign 0.19
R0718:Ltf UTSW 9 111040379 missense probably benign 0.01
R1899:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R1900:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R2964:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2965:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2966:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R3051:Ltf UTSW 9 111024522 missense probably benign 0.00
R3122:Ltf UTSW 9 111022900 missense probably damaging 1.00
R4597:Ltf UTSW 9 111022933 missense probably damaging 1.00
R4604:Ltf UTSW 9 111022341 missense probably damaging 0.99
R4827:Ltf UTSW 9 111027377 unclassified probably benign
R4849:Ltf UTSW 9 111025990 missense probably benign 0.00
R5389:Ltf UTSW 9 111029651 missense possibly damaging 0.50
R5677:Ltf UTSW 9 111020912 start codon destroyed probably null 0.01
R6419:Ltf UTSW 9 111031022 missense possibly damaging 0.67
R6891:Ltf UTSW 9 111025113 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTCAGGCACTTTTGTAGAGTG -3'
(R):5'- AACTCCCTGGTGAGAGTGTC -3'

Sequencing Primer
(F):5'- CAGGCACTTTTGTAGAGTGACTTCC -3'
(R):5'- TCCTTGAGTATCAGGCACACATG -3'
Posted On2015-07-07