Incidental Mutation 'R4427:Poc1b'
ID328236
Institutional Source Beutler Lab
Gene Symbol Poc1b
Ensembl Gene ENSMUSG00000019952
Gene NamePOC1 centriolar protein B
Synonyms4933430F16Rik, Wdr51b
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99107036-99198074 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 99155139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159043] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000219884]
Predicted Effect probably null
Transcript: ENSMUST00000020113
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159043
SMART Domains Protein: ENSMUSP00000123719
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 2 38 5.95e-7 SMART
Blast:WD40 41 75 9e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159228
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159990
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219884
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutation in this gene result in autosomal-recessive cone-rod dystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Poc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Poc1b APN 10 99129652 missense probably benign 0.29
IGL01314:Poc1b APN 10 99129641 missense probably damaging 1.00
IGL02503:Poc1b APN 10 99144348 splice site probably benign
IGL02839:Poc1b APN 10 99144598 splice site probably benign
IGL02966:Poc1b APN 10 99144314 missense probably damaging 1.00
R0708:Poc1b UTSW 10 99155130 missense probably null 0.99
R0723:Poc1b UTSW 10 99129595 missense probably damaging 1.00
R1423:Poc1b UTSW 10 99152863 missense probably damaging 1.00
R4383:Poc1b UTSW 10 99156299 missense probably damaging 1.00
R4426:Poc1b UTSW 10 99155139 critical splice donor site probably null
R5076:Poc1b UTSW 10 99107841 missense probably damaging 0.98
R6355:Poc1b UTSW 10 99129574 missense probably damaging 1.00
R6731:Poc1b UTSW 10 99152871 missense probably null 1.00
R6833:Poc1b UTSW 10 99192804 missense probably benign 0.16
R6834:Poc1b UTSW 10 99192804 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTCTATCGGACACGTGTTACTAC -3'
(R):5'- ACTGGGCATTCAGTGTCAAC -3'

Sequencing Primer
(F):5'- CGGACACGTGTTACTACATAGATAGC -3'
(R):5'- ACTGGGCATTCAGTGTCAACTAAATG -3'
Posted On2015-07-07