Incidental Mutation 'R4427:Gas2l1'
ID328237
Institutional Source Beutler Lab
Gene Symbol Gas2l1
Ensembl Gene ENSMUSG00000034201
Gene Namegrowth arrest-specific 2 like 1
Synonyms4930500E24Rik, D0Jmb1, TU-71.1, GAR22
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5054132-5065327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5063908 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 184 (V184A)
Ref Sequence ENSEMBL: ENSMUSP00000121993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037146] [ENSMUST00000037218] [ENSMUST00000056649] [ENSMUST00000109895] [ENSMUST00000152257]
Predicted Effect probably benign
Transcript: ENSMUST00000037146
AA Change: V184A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043709
Gene: ENSMUSG00000034201
AA Change: V184A

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037218
SMART Domains Protein: ENSMUSP00000048453
Gene: ENSMUSG00000034209

DomainStartEndE-ValueType
Pfam:Ras 6 180 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056649
AA Change: V184A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050275
Gene: ENSMUSG00000034201
AA Change: V184A

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109895
AA Change: V184A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105521
Gene: ENSMUSG00000034201
AA Change: V184A

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151936
Predicted Effect probably benign
Transcript: ENSMUST00000152257
AA Change: V184A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121993
Gene: ENSMUSG00000034201
AA Change: V184A

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156196
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: This gene encodes a member of the Gas2 family, actin-associated proteins expressed at high levels in growth-arrested cells. The gene expression is negatively regulated by serum and growth factors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Gas2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Gas2l1 UTSW 11 5062319 unclassified probably benign
R1606:Gas2l1 UTSW 11 5064434 missense probably damaging 1.00
R1719:Gas2l1 UTSW 11 5064266 missense probably damaging 1.00
R1934:Gas2l1 UTSW 11 5061408 missense probably benign 0.00
R4426:Gas2l1 UTSW 11 5063908 missense probably benign
R4705:Gas2l1 UTSW 11 5060867 missense possibly damaging 0.71
R4811:Gas2l1 UTSW 11 5064436 missense probably damaging 1.00
R4817:Gas2l1 UTSW 11 5061429 missense possibly damaging 0.73
R4847:Gas2l1 UTSW 11 5064173 missense probably damaging 1.00
R5212:Gas2l1 UTSW 11 5061108 missense probably benign 0.24
R6753:Gas2l1 UTSW 11 5064254 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTCTTAGTGGGGAAGGCTG -3'
(R):5'- TGGTGCTACGCAAGAACGAG -3'

Sequencing Primer
(F):5'- TGAGAATGGGCCCCTGGAG -3'
(R):5'- AGAAGAGTGTGGTGCTCTGCC -3'
Posted On2015-07-07