Incidental Mutation 'R4427:Pwwp2a'
ID328240
Institutional Source Beutler Lab
Gene Symbol Pwwp2a
Ensembl Gene ENSMUSG00000044950
Gene NamePWWP domain containing 2A
Synonyms
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4427 (G1)
Quality Score160
Status Not validated
Chromosome11
Chromosomal Location43681998-43721491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43682517 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000091852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061070] [ENSMUST00000094294] [ENSMUST00000109280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061070
AA Change: V142A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054154
Gene: ENSMUSG00000044950
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 488 509 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 566 576 N/A INTRINSIC
low complexity region 588 598 N/A INTRINSIC
Pfam:PWWP 628 714 5.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094294
AA Change: V142A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091852
Gene: ENSMUSG00000044950
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109280
SMART Domains Protein: ENSMUSP00000104903
Gene: ENSMUSG00000044950

DomainStartEndE-ValueType
low complexity region 213 234 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Pfam:PWWP 353 438 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148461
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Pwwp2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Pwwp2a APN 11 43706128 missense possibly damaging 0.46
IGL02227:Pwwp2a APN 11 43705621 missense possibly damaging 0.93
IGL02653:Pwwp2a APN 11 43706035 missense possibly damaging 0.69
IGL03258:Pwwp2a APN 11 43704565 missense probably benign 0.21
R0376:Pwwp2a UTSW 11 43704672 missense probably benign 0.00
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R2127:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2128:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2173:Pwwp2a UTSW 11 43682486 missense probably benign 0.01
R3077:Pwwp2a UTSW 11 43705385 missense probably damaging 1.00
R3436:Pwwp2a UTSW 11 43706188 nonsense probably null
R3437:Pwwp2a UTSW 11 43706188 nonsense probably null
R5597:Pwwp2a UTSW 11 43682595 missense probably benign 0.34
R5672:Pwwp2a UTSW 11 43706141 missense probably damaging 1.00
R6132:Pwwp2a UTSW 11 43705628 missense probably damaging 1.00
R6197:Pwwp2a UTSW 11 43704596 missense probably benign 0.00
R6563:Pwwp2a UTSW 11 43705765 missense possibly damaging 0.88
R6709:Pwwp2a UTSW 11 43704727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCTCCGAGGCTGAGGA -3'
(R):5'- CATTAACCCATCTGCCCCAGTG -3'

Sequencing Primer
(F):5'- TGAGGAGGCGAAGCCGCCCG -3'
(R):5'- TGTGCCAGCCATCTGCAC -3'
Posted On2015-07-07