Incidental Mutation 'R4427:Evi2'
ID328243
Institutional Source Beutler Lab
Gene Symbol Evi2
Ensembl Gene ENSMUSG00000070354
Gene Nameecotropic viral integration site 2
SynonymsGm21975
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79513385-79530589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79516356 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 131 (Q131L)
Ref Sequence ENSEMBL: ENSMUSP00000136153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000093983] [ENSMUST00000108251] [ENSMUST00000170422] [ENSMUST00000179322]
Predicted Effect probably benign
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093983
SMART Domains Protein: ENSMUSP00000091519
Gene: ENSMUSG00000070354

DomainStartEndE-ValueType
Pfam:EVI2A 1 75 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170422
AA Change: Q131L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128569
Gene: ENSMUSG00000070354
AA Change: Q131L

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179322
AA Change: Q131L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136153
Gene: ENSMUSG00000093938
AA Change: Q131L

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Evi2a (ecotropic viral integration site 2a) and Evi2b (ecotropic viral integration site 2b) genes on chromosome 11. The readthrough transcript encodes a protein identical to that of the downstream gene product. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Evi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1540:Evi2 UTSW 11 79515586 missense probably benign 0.05
R1570:Evi2 UTSW 11 79516250 missense possibly damaging 0.55
R3862:Evi2 UTSW 11 79515646 missense probably benign 0.01
R3863:Evi2 UTSW 11 79515646 missense probably benign 0.01
R3864:Evi2 UTSW 11 79515646 missense probably benign 0.01
R4796:Evi2 UTSW 11 79515447 intron probably benign
R6342:Evi2 UTSW 11 79515958 missense probably benign 0.01
R6946:Evi2 UTSW 11 79516194 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTATGAGCAGTTCCTTTGCCAC -3'
(R):5'- CTTCTGGACAGCAAGCATCACC -3'

Sequencing Primer
(F):5'- GCAGTTCCTTTGCCACTTGGTG -3'
(R):5'- TCACCTGCCCAAATCACTCCTG -3'
Posted On2015-07-07