Incidental Mutation 'R4427:Utp18'
ID328244
Institutional Source Beutler Lab
Gene Symbol Utp18
Ensembl Gene ENSMUSG00000054079
Gene NameUTP18 small subunit processome component
Synonyms6230425C22Rik, Wdr50
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93859243-93885766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93866438 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 467 (N467D)
Ref Sequence ENSEMBL: ENSMUSP00000068103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066888]
Predicted Effect probably damaging
Transcript: ENSMUST00000066888
AA Change: N467D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068103
Gene: ENSMUSG00000054079
AA Change: N467D

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 100 111 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
WD40 236 275 7.4e0 SMART
WD40 280 320 3.08e0 SMART
Blast:WD40 325 365 4e-17 BLAST
WD40 368 406 2.23e-1 SMART
WD40 409 449 1.78e0 SMART
WD40 458 499 2.05e1 SMART
WD40 510 545 7.92e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130797
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Utp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Utp18 APN 11 93869848 missense possibly damaging 0.95
IGL02061:Utp18 APN 11 93882141 missense probably benign 0.05
IGL02402:Utp18 APN 11 93883791 unclassified probably benign
IGL02552:Utp18 APN 11 93868334 missense probably damaging 0.97
IGL03086:Utp18 APN 11 93876056 missense probably damaging 1.00
IGL03090:Utp18 APN 11 93868419 missense probably damaging 1.00
IGL03281:Utp18 APN 11 93875958 missense probably damaging 1.00
R0042:Utp18 UTSW 11 93875858 missense probably damaging 0.99
R0281:Utp18 UTSW 11 93882177 unclassified probably benign
R0399:Utp18 UTSW 11 93880147 splice site probably benign
R0543:Utp18 UTSW 11 93875835 missense probably damaging 1.00
R1512:Utp18 UTSW 11 93885564 missense probably benign 0.00
R1674:Utp18 UTSW 11 93876053 critical splice donor site probably null
R2013:Utp18 UTSW 11 93876122 missense possibly damaging 0.91
R4426:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4455:Utp18 UTSW 11 93885447 missense probably benign 0.09
R4458:Utp18 UTSW 11 93870533 missense possibly damaging 0.92
R5085:Utp18 UTSW 11 93870537 missense possibly damaging 0.78
R5297:Utp18 UTSW 11 93876089 missense probably damaging 0.99
R5321:Utp18 UTSW 11 93866434 missense probably damaging 1.00
R6006:Utp18 UTSW 11 93885623 missense probably benign 0.00
R6845:Utp18 UTSW 11 93885756 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCACACACTACTATTCTGTTATCAC -3'
(R):5'- TACAATTGAAAAGCTGCTCGGC -3'

Sequencing Primer
(F):5'- GTTATCACTCACTGTTTTAACATGAC -3'
(R):5'- GTCTCCGCGTTGAATTCTTCAG -3'
Posted On2015-07-07