Incidental Mutation 'R0038:Fbxw28'
ID32825
Institutional Source Beutler Lab
Gene Symbol Fbxw28
Ensembl Gene ENSMUSG00000054087
Gene NameF-box and WD-40 domain protein 28
SynonymsGm9337
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0038 (G1)
Quality Score172
Status Validated (trace)
Chromosome9
Chromosomal Location109322886-109339659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109338540 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 50 (W50R)
Ref Sequence ENSEMBL: ENSMUSP00000107670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112039] [ENSMUST00000112040] [ENSMUST00000196351] [ENSMUST00000200156]
Predicted Effect probably damaging
Transcript: ENSMUST00000112039
AA Change: W50R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107670
Gene: ENSMUSG00000054087
AA Change: W50R

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112040
AA Change: W50R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107671
Gene: ENSMUSG00000054087
AA Change: W50R

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196351
AA Change: W50R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143357
Gene: ENSMUSG00000054087
AA Change: W50R

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1aym1_ 54 102 2e-3 SMART
Blast:WD40 172 211 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200156
AA Change: W50R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143361
Gene: ENSMUSG00000054087
AA Change: W50R

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1tbga_ 127 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Meta Mutation Damage Score 0.482 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Fbxw28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Fbxw28 APN 9 109328325 missense probably benign 0.05
IGL02080:Fbxw28 APN 9 109339573 missense probably damaging 1.00
IGL02313:Fbxw28 APN 9 109337352 missense possibly damaging 0.76
R0029:Fbxw28 UTSW 9 109328289 missense probably damaging 1.00
R0058:Fbxw28 UTSW 9 109328211 missense probably benign 0.22
R1288:Fbxw28 UTSW 9 109337293 missense probably damaging 0.97
R1898:Fbxw28 UTSW 9 109323384 missense probably benign 0.32
R2065:Fbxw28 UTSW 9 109328224 missense probably benign 0.03
R2117:Fbxw28 UTSW 9 109330917 missense probably benign 0.04
R3410:Fbxw28 UTSW 9 109338404 missense possibly damaging 0.55
R3812:Fbxw28 UTSW 9 109338530 missense possibly damaging 0.83
R4400:Fbxw28 UTSW 9 109328310 missense probably damaging 1.00
R4840:Fbxw28 UTSW 9 109339534 missense probably null 1.00
R4899:Fbxw28 UTSW 9 109330853 missense probably damaging 0.99
R5129:Fbxw28 UTSW 9 109326603 missense probably damaging 1.00
R5613:Fbxw28 UTSW 9 109338533 missense probably benign 0.02
R5777:Fbxw28 UTSW 9 109338536 missense probably damaging 0.98
R6029:Fbxw28 UTSW 9 109329425 missense probably damaging 1.00
R6235:Fbxw28 UTSW 9 109326190 missense probably damaging 1.00
R6367:Fbxw28 UTSW 9 109339531 critical splice donor site probably null
R6820:Fbxw28 UTSW 9 109338425 missense probably damaging 1.00
R6968:Fbxw28 UTSW 9 109330788 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTGTGACACAGAAACACTGTGCC -3'
(R):5'- GCCTTCTGATTCTGGACATGGACC -3'

Sequencing Primer
(F):5'- AAACCAAGTGGGTGTCTCTTC -3'
(R):5'- ATTCTGGACATGGACCAGTGATG -3'
Posted On2013-05-09