Incidental Mutation 'R4427:Rps6ka2'
ID328250
Institutional Source Beutler Lab
Gene Symbol Rps6ka2
Ensembl Gene ENSMUSG00000023809
Gene Nameribosomal protein S6 kinase, polypeptide 2
SynonymsRps6ka-rs1, pp90rsk, p90rsk, D17Wsu134e, 90kDa, Rsk3
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location7170115-7303315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7299405 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 687 (D687E)
Ref Sequence ENSEMBL: ENSMUSP00000024575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024575
AA Change: D687E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024575
Gene: ENSMUSG00000023809
AA Change: D687E

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
S_TKc 59 318 6.25e-107 SMART
S_TK_X 319 380 3.36e-20 SMART
S_TKc 415 672 1.84e-104 SMART
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains two non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternative splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased response of heart to stress following transverse aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Rps6ka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Rps6ka2 APN 17 7236124 missense probably benign 0.02
IGL02199:Rps6ka2 APN 17 7254453 splice site probably benign
IGL02458:Rps6ka2 APN 17 7289003 missense probably benign 0.04
IGL02532:Rps6ka2 APN 17 7255966 missense probably damaging 1.00
IGL02741:Rps6ka2 APN 17 7296016 missense probably benign 0.22
IGL02860:Rps6ka2 APN 17 7282856 missense possibly damaging 0.68
IGL02948:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03037:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03085:Rps6ka2 APN 17 7295280 critical splice donor site probably null
IGL03302:Rps6ka2 APN 17 7299388 missense possibly damaging 0.83
IGL03303:Rps6ka2 APN 17 7228012 nonsense probably null
R0083:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0108:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0145:Rps6ka2 UTSW 17 7262186 missense probably benign 0.09
R0257:Rps6ka2 UTSW 17 7227983 missense probably damaging 1.00
R0355:Rps6ka2 UTSW 17 7271610 missense probably benign 0.03
R0563:Rps6ka2 UTSW 17 7254437 missense probably damaging 1.00
R1065:Rps6ka2 UTSW 17 7281758 splice site probably benign
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1540:Rps6ka2 UTSW 17 7292906 missense probably null 1.00
R1708:Rps6ka2 UTSW 17 7277530 missense probably damaging 0.99
R2418:Rps6ka2 UTSW 17 7299339 missense possibly damaging 0.76
R2697:Rps6ka2 UTSW 17 7300322 missense probably benign 0.07
R4753:Rps6ka2 UTSW 17 7299308 missense possibly damaging 0.86
R4951:Rps6ka2 UTSW 17 7292789 missense probably damaging 1.00
R4954:Rps6ka2 UTSW 17 7271604 missense probably benign 0.00
R4954:Rps6ka2 UTSW 17 7299286 missense probably benign
R6298:Rps6ka2 UTSW 17 7170367 missense possibly damaging 0.92
R6800:Rps6ka2 UTSW 17 7251636 missense probably damaging 1.00
R6905:Rps6ka2 UTSW 17 7227941 missense probably damaging 1.00
R6952:Rps6ka2 UTSW 17 7227978 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGAATCACCTCAGAGG -3'
(R):5'- GTGTGATAAAGTGACACTTACGTG -3'

Sequencing Primer
(F):5'- TCTCTGGCCAGCCTGACAC -3'
(R):5'- AAGTGACACTTACGTGCCTATACCTG -3'
Posted On2015-07-07