Incidental Mutation 'R4427:Gsto2'
ID328255
Institutional Source Beutler Lab
Gene Symbol Gsto2
Ensembl Gene ENSMUSG00000025069
Gene Nameglutathione S-transferase omega 2
Synonyms4930425C18Rik, 1700020F09Rik
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47865545-47886324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47871773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000113409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056159] [ENSMUST00000120645] [ENSMUST00000135016]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect possibly damaging
Transcript: ENSMUST00000056159
AA Change: S2P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052592
Gene: ENSMUSG00000025069
AA Change: S2P

DomainStartEndE-ValueType
Pfam:GST_N 23 95 1.7e-9 PFAM
Pfam:Glutaredoxin 24 75 1.1e-7 PFAM
Pfam:GST_N_3 26 101 1.9e-21 PFAM
Pfam:GST_N_2 31 96 3.2e-14 PFAM
SCOP:d1eema1 104 242 3e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120645
AA Change: S2P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113409
Gene: ENSMUSG00000025069
AA Change: S2P

DomainStartEndE-ValueType
Pfam:GST_N 22 95 3.8e-14 PFAM
Pfam:Glutaredoxin 24 75 9e-8 PFAM
Pfam:GST_N_3 26 101 6.9e-22 PFAM
Pfam:GST_N_2 31 96 1.7e-14 PFAM
SCOP:d1eema1 104 242 3e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135016
AA Change: S2P

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119680
Gene: ENSMUSG00000025069
AA Change: S2P

DomainStartEndE-ValueType
Pfam:GST_N 23 95 3.4e-10 PFAM
Pfam:Glutaredoxin 24 75 4.4e-8 PFAM
Pfam:GST_N_3 26 101 4.2e-22 PFAM
Pfam:GST_N_2 31 96 6e-15 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an omega class glutathione S-transferase (GST). GSTs are involved in the metabolism of xenobiotics and carcinogens. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Gsto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Gsto2 APN 19 47874967 missense probably damaging 1.00
IGL02561:Gsto2 APN 19 47886190 unclassified probably benign
IGL02820:Gsto2 APN 19 47874959 missense probably damaging 1.00
IGL03141:Gsto2 APN 19 47874873 missense probably damaging 1.00
R1343:Gsto2 UTSW 19 47884707 unclassified probably null
R4297:Gsto2 UTSW 19 47876496 missense possibly damaging 0.49
R4701:Gsto2 UTSW 19 47884656 missense probably benign 0.02
R4762:Gsto2 UTSW 19 47874873 missense probably damaging 1.00
R6765:Gsto2 UTSW 19 47871788 nonsense probably null
X0018:Gsto2 UTSW 19 47874901 missense probably benign 0.12
X0067:Gsto2 UTSW 19 47886022 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATATCTGGGGCGGTATCTG -3'
(R):5'- GAGAGTCTGGTTAGCCCATTGG -3'

Sequencing Primer
(F):5'- ATCTGTGAGGGGCTAGGTTATACAG -3'
(R):5'- TGTTCTCCTCAAGGACATTCAAGGAG -3'
Posted On2015-07-07