Incidental Mutation 'R4428:Cd82'
ID328259
Institutional Source Beutler Lab
Gene Symbol Cd82
Ensembl Gene ENSMUSG00000027215
Gene NameCD82 antigen
SynonymsC33, Kai1, Tspan27
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93419111-93463140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93419869 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 266 (Y266C)
Ref Sequence ENSEMBL: ENSMUSP00000112158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028644] [ENSMUST00000099696] [ENSMUST00000111257] [ENSMUST00000116457] [ENSMUST00000123565] [ENSMUST00000145553] [ENSMUST00000150508]
Predicted Effect probably damaging
Transcript: ENSMUST00000028644
AA Change: Y266C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028644
Gene: ENSMUSG00000027215
AA Change: Y266C

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 255 4.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099696
AA Change: Y266C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097287
Gene: ENSMUSG00000027215
AA Change: Y266C

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 255 1.6e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111257
AA Change: Y266C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106888
Gene: ENSMUSG00000027215
AA Change: Y266C

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 255 4.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116457
AA Change: Y266C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112158
Gene: ENSMUSG00000027215
AA Change: Y266C

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 255 4.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123565
SMART Domains Protein: ENSMUSP00000114762
Gene: ENSMUSG00000027215

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 178 1.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137073
Predicted Effect probably benign
Transcript: ENSMUST00000145553
SMART Domains Protein: ENSMUSP00000115310
Gene: ENSMUSG00000027215

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 146 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150508
SMART Domains Protein: ENSMUSP00000120183
Gene: ENSMUSG00000027215

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 146 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184769
Meta Mutation Damage Score 0.486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This metastasis suppressor gene product is a membrane glycoprotein that is a member of the transmembrane 4 superfamily. Expression of this gene has been shown to be downregulated in tumor progression of human cancers and can be activated by p53 through a consensus binding sequence in the promoter. Its expression and that of p53 are strongly correlated, and the loss of expression of these two proteins is associated with poor survival for prostate cancer patients. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pathalogical angiogenesis with increased vascular endothelial cell migration and invasion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Cd82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Cd82 APN 2 93420659 missense probably null 0.89
R0007:Cd82 UTSW 2 93433881 missense probably benign
R1762:Cd82 UTSW 2 93437429 missense probably damaging 0.98
R6495:Cd82 UTSW 2 93430012 missense probably benign 0.00
R6773:Cd82 UTSW 2 93421876 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATATTGGTGGCAGAAGGAC -3'
(R):5'- ACGTCAGATTGGGTACTGTCC -3'

Sequencing Primer
(F):5'- GACAGGGAGAAGGGCCC -3'
(R):5'- TCTGGGCCTCCTTCAGCAG -3'
Posted On2015-07-07