Incidental Mutation 'R4428:Sema3d'
ID328268
Institutional Source Beutler Lab
Gene Symbol Sema3d
Ensembl Gene ENSMUSG00000040254
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms4631426B19Rik
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location12383385-12588948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12448120 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 31 (F31S)
Ref Sequence ENSEMBL: ENSMUSP00000142453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030868] [ENSMUST00000197927]
Predicted Effect probably benign
Transcript: ENSMUST00000030868
AA Change: F31S

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030868
Gene: ENSMUSG00000040254
AA Change: F31S

DomainStartEndE-ValueType
transmembrane domain 16 35 N/A INTRINSIC
Sema 70 515 2.97e-207 SMART
PSI 533 585 2.03e-13 SMART
IG 598 682 1.39e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196618
Predicted Effect probably benign
Transcript: ENSMUST00000197927
AA Change: F31S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142453
Gene: ENSMUSG00000040254
AA Change: F31S

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Sema 70 515 1e-209 SMART
PSI 533 585 8.5e-16 SMART
Blast:Sema 590 622 1e-9 BLAST
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin like domain and a C-terminal basic domain. The protein encoded by this gene binds neuropilin and plays an important role in cardiovascular development. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pulmonary vein connection to the right atrium and atrial septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Sema3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3d APN 5 12563222 missense probably benign 0.01
IGL00582:Sema3d APN 5 12585195 missense probably damaging 1.00
IGL00661:Sema3d APN 5 12505839 missense probably damaging 1.00
IGL00780:Sema3d APN 5 12524326 missense probably damaging 1.00
IGL01531:Sema3d APN 5 12541080 missense probably benign
IGL01957:Sema3d APN 5 12563315 missense probably damaging 1.00
IGL02100:Sema3d APN 5 12584991 missense probably benign 0.29
IGL02676:Sema3d APN 5 12570978 missense probably benign 0.38
IGL02749:Sema3d APN 5 12563145 splice site probably benign
IGL02827:Sema3d APN 5 12585118 missense probably benign 0.04
IGL03325:Sema3d APN 5 12463222 missense probably damaging 0.99
R0050:Sema3d UTSW 5 12584953 missense probably benign 0.00
R0085:Sema3d UTSW 5 12570986 missense probably benign 0.00
R0095:Sema3d UTSW 5 12563347 missense probably damaging 1.00
R0157:Sema3d UTSW 5 12508137 missense possibly damaging 0.95
R0328:Sema3d UTSW 5 12448075 missense possibly damaging 0.48
R0924:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R0930:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R1609:Sema3d UTSW 5 12541056 missense probably damaging 1.00
R1657:Sema3d UTSW 5 12584974 missense possibly damaging 0.82
R1669:Sema3d UTSW 5 12508084 splice site probably benign
R1795:Sema3d UTSW 5 12584887 missense probably benign 0.02
R1861:Sema3d UTSW 5 12497603 missense probably benign 0.00
R1889:Sema3d UTSW 5 12485021 splice site probably null
R1895:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1946:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12563318 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12584998 missense probably benign
R2117:Sema3d UTSW 5 12563273 missense probably benign
R2148:Sema3d UTSW 5 12484959 missense probably damaging 0.99
R2276:Sema3d UTSW 5 12542582 missense possibly damaging 0.63
R3761:Sema3d UTSW 5 12571037 missense probably damaging 1.00
R4063:Sema3d UTSW 5 12585124 missense probably benign 0.25
R4903:Sema3d UTSW 5 12563158 missense probably benign 0.00
R4999:Sema3d UTSW 5 12508087 splice site probably null
R5000:Sema3d UTSW 5 12448038 missense probably benign 0.01
R5022:Sema3d UTSW 5 12584956 missense probably damaging 1.00
R5186:Sema3d UTSW 5 12584908 missense probably benign
R5584:Sema3d UTSW 5 12566008 missense possibly damaging 0.49
R5584:Sema3d UTSW 5 12570987 missense possibly damaging 0.73
R6270:Sema3d UTSW 5 12448107 missense probably benign
R6368:Sema3d UTSW 5 12571013 missense probably damaging 1.00
R6426:Sema3d UTSW 5 12563264 missense probably damaging 1.00
R6750:Sema3d UTSW 5 12585100 nonsense probably null
R7403:Sema3d UTSW 5 12497584 missense probably damaging 0.97
R7450:Sema3d UTSW 5 12584934 nonsense probably null
R7470:Sema3d UTSW 5 12508185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCCTTGGCAACCTGTTATC -3'
(R):5'- TCTCAGCTATTGTAGACTGTGAAAC -3'

Sequencing Primer
(F):5'- CAGAAAACTTGCTAACTCTAGGAG -3'
(R):5'- CCTTGGAATAGTAACAGTAATTAG -3'
Posted On2015-07-07