Incidental Mutation 'R4428:Ccdc18'
ID328270
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108136077 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 82 (Y82C)
Ref Sequence ENSEMBL: ENSMUSP00000142963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002837] [ENSMUST00000047677] [ENSMUST00000061203] [ENSMUST00000117759] [ENSMUST00000118036] [ENSMUST00000119437] [ENSMUST00000119784] [ENSMUST00000197718]
Predicted Effect probably benign
Transcript: ENSMUST00000002837
SMART Domains Protein: ENSMUSP00000002837
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EMP24_GP25L 35 222 5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047677
AA Change: Y82C

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: Y82C

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061203
SMART Domains Protein: ENSMUSP00000056449
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 112 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117759
SMART Domains Protein: ENSMUSP00000112612
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 100 4.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118036
SMART Domains Protein: ENSMUSP00000113922
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 99 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119437
SMART Domains Protein: ENSMUSP00000112406
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EMP24_GP25L 35 160 9.65e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119784
SMART Domains Protein: ENSMUSP00000113422
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 96 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197718
AA Change: Y82C

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531
AA Change: Y82C

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200463
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGGAAACACAGTCTTATGCTC -3'
(R):5'- TCTGACCTCTACATCATATGCAGAC -3'

Sequencing Primer
(F):5'- GGAAACACAGTCTTATGCTCATAAC -3'
(R):5'- TCATATGCAGACAAAACACTCATC -3'
Posted On2015-07-07