Incidental Mutation 'R4428:Siglecg'
ID328275
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Namesialic acid binding Ig-like lectin G
SynonymsmSiglec-G, A630096C01Rik
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43408204-43418358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43417926 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 639 (P639L)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005592
AA Change: P639L

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: P639L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154322
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43409057 missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43411795 missense probably benign 0.02
IGL01806:Siglecg APN 7 43411464 splice site probably null
IGL01947:Siglecg APN 7 43408763 missense probably benign 0.43
IGL02257:Siglecg APN 7 43411904 missense probably benign 0.00
IGL02410:Siglecg APN 7 43408829 missense probably damaging 0.99
IGL02454:Siglecg APN 7 43408895 missense probably benign 0.00
Chamonix UTSW 7 43409422 missense possibly damaging 0.91
Montblanc UTSW 7 43411386 intron probably benign
Shenandoah UTSW 7 43408802 missense probably damaging 0.99
shenandoah2 UTSW 7 43412017 missense possibly damaging 0.82
Sherando UTSW 7 43409057 missense possibly damaging 0.64
IGL02988:Siglecg UTSW 7 43418052 missense probably damaging 1.00
R0134:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0225:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0480:Siglecg UTSW 7 43411126 missense probably benign 0.42
R1538:Siglecg UTSW 7 43417889 missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43408941 missense probably benign 0.17
R2358:Siglecg UTSW 7 43409422 missense possibly damaging 0.91
R4429:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43417908 missense probably benign 0.03
R4754:Siglecg UTSW 7 43411871 intron probably benign
R5017:Siglecg UTSW 7 43411386 intron probably benign
R5713:Siglecg UTSW 7 43408802 missense probably damaging 0.99
R5777:Siglecg UTSW 7 43409413 missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43412204 intron probably benign
R6153:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43408754 missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43409057 missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43408979 missense probably benign 0.00
R7066:Siglecg UTSW 7 43411742 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTGATTCCTGTGACTCTAAAGCTAG -3'
(R):5'- TAGGTCTCAGTCCTAAGCCC -3'

Sequencing Primer
(F):5'- AGTTCCCAAGTCAGAGGCTG -3'
(R):5'- GCCCCAGGACACCCTCAG -3'
Posted On2015-07-07