Incidental Mutation 'R4428:Fgf3'
ID328277
Institutional Source Beutler Lab
Gene Symbol Fgf3
Ensembl Gene ENSMUSG00000031074
Gene Namefibroblast growth factor 3
SynonymsInt-P, Int-2, Fgf-3
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144838083-144844436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144840707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000101518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105898] [ENSMUST00000155320]
Predicted Effect probably damaging
Transcript: ENSMUST00000105898
AA Change: V86A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101518
Gene: ENSMUSG00000031074
AA Change: V86A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FGF 42 182 1.13e-66 SMART
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155320
AA Change: V86A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115205
Gene: ENSMUSG00000031074
AA Change: V86A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FGF 42 154 3.75e-40 SMART
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumors in the mouse. Frequent amplification of this gene has been found in human tumors, which may be important for neoplastic transformation and tumor progression. Studies of the similar genes in mouse and chicken suggested the role in inner ear formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have short, thickened and curved tails. Otic vesicles are somewhat smaller than normal. Mice with some alleles apparently display more severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Fgf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Fgf3 APN 7 144840784 splice site probably benign
IGL02679:Fgf3 APN 7 144840750 missense probably damaging 1.00
Porkchop UTSW 7 144840707 missense probably damaging 1.00
R0471:Fgf3 UTSW 7 144842810 missense probably damaging 1.00
R1351:Fgf3 UTSW 7 144840780 splice site probably benign
R5184:Fgf3 UTSW 7 144842810 missense probably damaging 1.00
R5677:Fgf3 UTSW 7 144838783 nonsense probably null
R5756:Fgf3 UTSW 7 144842951 missense probably benign 0.44
R7267:Fgf3 UTSW 7 144838832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAAGGTCTCCCGCACAGTG -3'
(R):5'- TTGAGTCTGGCATGACCTG -3'

Sequencing Primer
(F):5'- GCACAGTGGCAGGATGC -3'
(R):5'- ACCTGGGGGCTAAGAAGTCTATCTC -3'
Posted On2015-07-07