Incidental Mutation 'R4428:Trhde'
ID328280
Institutional Source Beutler Lab
Gene Symbol Trhde
Ensembl Gene ENSMUSG00000050663
Gene NameTRH-degrading enzyme
Synonyms
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location114398823-114802307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114503123 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 594 (L594Q)
Ref Sequence ENSEMBL: ENSMUSP00000057449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061632]
Predicted Effect probably damaging
Transcript: ENSMUST00000061632
AA Change: L594Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: L594Q

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Peptidase_M1 141 531 2.6e-141 PFAM
Pfam:ERAP1_C 679 1004 5.7e-65 PFAM
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Trhde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Trhde APN 10 114486747 missense possibly damaging 0.77
IGL00516:Trhde APN 10 114446199 missense probably benign 0.01
IGL01371:Trhde APN 10 114588500 missense possibly damaging 0.57
IGL01488:Trhde APN 10 114446158 missense possibly damaging 0.58
IGL01602:Trhde APN 10 114787943 missense probably benign
IGL01605:Trhde APN 10 114787943 missense probably benign
IGL02150:Trhde APN 10 114592108 missense probably damaging 1.00
IGL02165:Trhde APN 10 114592161 missense probably damaging 1.00
IGL02340:Trhde APN 10 114592213 splice site probably benign
IGL02412:Trhde APN 10 114486925 missense probably damaging 1.00
IGL02421:Trhde APN 10 114412461 missense probably damaging 1.00
IGL02496:Trhde APN 10 114800561 nonsense probably null
IGL02952:Trhde APN 10 114800573 missense probably damaging 0.99
IGL03197:Trhde APN 10 114413308 missense probably benign 0.00
l3-37 UTSW 10 114801081 missense probably benign
R0360:Trhde UTSW 10 114502982 splice site probably benign
R0364:Trhde UTSW 10 114502982 splice site probably benign
R0457:Trhde UTSW 10 114448262 missense probably benign 0.37
R0589:Trhde UTSW 10 114448324 missense probably benign 0.01
R1132:Trhde UTSW 10 114412478 missense possibly damaging 0.86
R1288:Trhde UTSW 10 114801290 missense probably benign 0.37
R1569:Trhde UTSW 10 114446188 missense possibly damaging 0.78
R1776:Trhde UTSW 10 114800603 missense probably benign 0.06
R1781:Trhde UTSW 10 114588500 missense possibly damaging 0.57
R1927:Trhde UTSW 10 114800849 missense probably damaging 1.00
R1976:Trhde UTSW 10 114588431 missense possibly damaging 0.57
R2011:Trhde UTSW 10 114498793 missense probably benign 0.02
R2332:Trhde UTSW 10 114592165 missense probably damaging 1.00
R2356:Trhde UTSW 10 114401516 missense probably damaging 1.00
R3107:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3108:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3907:Trhde UTSW 10 114800696 missense possibly damaging 0.72
R4067:Trhde UTSW 10 114444680 nonsense probably null
R4214:Trhde UTSW 10 114788070 missense possibly damaging 0.51
R4429:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4430:Trhde UTSW 10 114503123 missense probably damaging 1.00
R5244:Trhde UTSW 10 114801081 missense probably benign
R5456:Trhde UTSW 10 114486760 missense possibly damaging 0.58
R5540:Trhde UTSW 10 114800592 missense probably benign 0.45
R5699:Trhde UTSW 10 114588502 missense probably benign 0.00
R5967:Trhde UTSW 10 114567134 missense probably damaging 1.00
R6326:Trhde UTSW 10 114567224 missense probably damaging 1.00
R6467:Trhde UTSW 10 114504198 missense probably damaging 1.00
R7028:Trhde UTSW 10 114518177 missense probably damaging 1.00
R7264:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7266:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7310:Trhde UTSW 10 114800573 missense probably damaging 0.99
R7460:Trhde UTSW 10 114413263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGATTAAAACAGTGGTCCAC -3'
(R):5'- TAACCATATAAGACTCTCGAGGC -3'

Sequencing Primer
(F):5'- ACAGTGGTCCACATATATTTTAGAAC -3'
(R):5'- ACTCTCGAGGCAAAAATTAATTTTAC -3'
Posted On2015-07-07