Incidental Mutation 'R4428:Klhdc1'
ID328287
Institutional Source Beutler Lab
Gene Symbol Klhdc1
Ensembl Gene ENSMUSG00000051890
Gene Namekelch domain containing 1
Synonyms
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69241176-69284632 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 69268226 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063445] [ENSMUST00000173419]
Predicted Effect probably benign
Transcript: ENSMUST00000063445
SMART Domains Protein: ENSMUSP00000068046
Gene: ENSMUSG00000051890

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.4e-11 PFAM
Pfam:Kelch_4 67 122 4.4e-7 PFAM
Pfam:Kelch_6 67 124 1.7e-7 PFAM
Pfam:Kelch_3 79 125 1.8e-8 PFAM
Pfam:Kelch_3 170 205 2.5e-7 PFAM
Pfam:Kelch_2 196 235 2.8e-8 PFAM
Pfam:Kelch_1 196 236 1.4e-6 PFAM
Pfam:Kelch_4 196 245 5.5e-7 PFAM
Pfam:Kelch_3 206 256 3.9e-8 PFAM
Pfam:Kelch_4 247 295 5.3e-10 PFAM
Pfam:Kelch_3 258 307 1.7e-7 PFAM
low complexity region 364 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124326
Predicted Effect probably benign
Transcript: ENSMUST00000173419
SMART Domains Protein: ENSMUSP00000134180
Gene: ENSMUSG00000051890

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.7e-11 PFAM
Pfam:Kelch_4 67 123 1.7e-8 PFAM
Pfam:Kelch_6 67 124 5.6e-8 PFAM
Pfam:Kelch_1 68 116 3.2e-6 PFAM
Pfam:Kelch_3 78 126 3.1e-9 PFAM
Pfam:Kelch_3 165 205 2.8e-8 PFAM
Pfam:Kelch_5 193 237 2.7e-6 PFAM
Pfam:Kelch_2 196 235 1.8e-8 PFAM
Pfam:Kelch_6 196 237 2.6e-8 PFAM
Pfam:Kelch_4 196 245 2e-7 PFAM
Pfam:Kelch_3 206 256 2.1e-7 PFAM
Pfam:Kelch_5 245 285 2.4e-6 PFAM
Pfam:Kelch_4 247 299 3.5e-11 PFAM
Pfam:Kelch_6 247 299 3.2e-8 PFAM
Pfam:Kelch_3 258 301 1.2e-7 PFAM
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Klhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Klhdc1 APN 12 69242008 missense possibly damaging 0.92
IGL01432:Klhdc1 APN 12 69251977 missense probably damaging 0.97
IGL02086:Klhdc1 APN 12 69283184 missense probably benign 0.18
IGL02212:Klhdc1 APN 12 69250766 missense probably damaging 1.00
IGL02548:Klhdc1 APN 12 69253718 missense probably benign 0.00
IGL02861:Klhdc1 APN 12 69251451 missense possibly damaging 0.85
R0446:Klhdc1 UTSW 12 69283308 missense probably benign
R0656:Klhdc1 UTSW 12 69258030 missense probably benign
R1528:Klhdc1 UTSW 12 69263198 missense probably benign 0.02
R3001:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R3002:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R4738:Klhdc1 UTSW 12 69283133 missense probably benign 0.07
R5009:Klhdc1 UTSW 12 69251938 missense possibly damaging 0.89
R5366:Klhdc1 UTSW 12 69283150 missense probably damaging 0.99
R5619:Klhdc1 UTSW 12 69258145 intron probably null
R5662:Klhdc1 UTSW 12 69283165 missense probably benign 0.07
R5911:Klhdc1 UTSW 12 69256251 missense possibly damaging 0.80
R5995:Klhdc1 UTSW 12 69250774 missense probably damaging 1.00
R6708:Klhdc1 UTSW 12 69259530 missense possibly damaging 0.75
R6992:Klhdc1 UTSW 12 69253757 missense probably damaging 1.00
R7224:Klhdc1 UTSW 12 69263149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCAGATAAAGGGCTGACC -3'
(R):5'- TCCAGACAACACTTCTGGTCC -3'

Sequencing Primer
(F):5'- CCAAGGCTGGGTTCTGAG -3'
(R):5'- GTGCTCTGCAGTTACCATAGCAAC -3'
Posted On2015-07-07